RchiOBHm_Chr2g0137201

Belongs to the iron ascorbate-dependent oxidoreductase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Forward (+)
54791942 .. 54792139
198 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 198 bp
ATGATTCTGGAGAGCTTGGGACTTGAGAAATACCTGGAGGAACACATAGGGTCAACAAAATACCTTCTTCGAGTCATGAAATATAAGGGCCCTCAAACCAGCCAGACTAAGCTGGGCCTAAACTCCCACACAGATAAGAACATTGTCACTATTCTGCACCAAAACCAAGTTGAAGGACTAGAGGTGCAAACCAATTAA

Protein Analysis

65

Amino Acids

7.41

Weight (kDa)

6.82

Isoelectric Point (pI)

32.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
2OG-FeII_Oxy PF03171 25 - 63 4.6e-07 2OG-Fe(II) oxygenase superfamily
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 173
AjnI CCWGG 1 cut(s) 33
AluBI AGCT 2 cut(s) 15, 112
AluI AGCT 2 cut(s) 15, 112
AoxI GGCC 2 cut(s) 88, 115
ApaI GGGCCC 1 cut(s) 92
AspS9I GGNCC 3 cut(s) 88, 89, 115
BaeGI GKGCMC 1 cut(s) 92
BanII GRGCYC 1 cut(s) 92
BciT130I CCWGG 1 cut(s) 35
BfaI CTAG 1 cut(s) 179
Bme1390I CCNGG 1 cut(s) 35
BmgT120I GGNCC 3 cut(s) 88, 89, 115
BmiI GGNNCC 1 cut(s) 90
BmrFI CCNGG 1 cut(s) 35
BpmI CTGGAG 2 cut(s) 29, 56
BpuEI CTTGAG 1 cut(s) 44
BseBI CCWGG 1 cut(s) 35
BseSI GKGCMC 1 cut(s) 92
BseYI CCCAGC 1 cut(s) 112
BsgI GTGCAG 1 cut(s) 140
BshFI GGCC 2 cut(s) 90, 117
BslFI GGGAC 1 cut(s) 33
BsmFI GGGAC 1 cut(s) 33
BsnI GGCC 2 cut(s) 90, 117
Bsp120I GGGCCC 1 cut(s) 88
Bsp1286I GDGCHC 1 cut(s) 92
BspANI GGCC 2 cut(s) 90, 117
BspHI TCATGA 1 cut(s) 75
BspLI GGNNCC 1 cut(s) 90
Bst2UI CCWGG 1 cut(s) 35
BstDEI CTNAG 1 cut(s) 108
BstNI CCWGG 1 cut(s) 35
BstSCI CCNGG 1 cut(s) 33
BstSLI GKGCMC 1 cut(s) 92
BsuRI GGCC 2 cut(s) 90, 117
CciI TCATGA 1 cut(s) 75
Cfr13I GGNCC 3 cut(s) 88, 89, 115
CviAII CATG 1 cut(s) 76
CviJI RGCY 5 cut(s) 15, 90, 102, 112, 117
CviKI_1 RGCY 5 cut(s) 15, 90, 102, 112, 117
DdeI CTNAG 1 cut(s) 108
Eco24I GRGCYC 1 cut(s) 92
EcoO109I RGGNCCY 2 cut(s) 88, 89
EcoRII CCWGG 1 cut(s) 33
EcoT38I GRGCYC 1 cut(s) 92
FaeI CATG 1 cut(s) 79
FaiI YATR 3 cut(s) 47, 77, 84
FaqI GGGAC 1 cut(s) 33
FatI CATG 1 cut(s) 75
FriOI GRGCYC 1 cut(s) 92
FspBI CTAG 1 cut(s) 179
GsaI CCCAGC 1 cut(s) 116
GsuI CTGGAG 2 cut(s) 29, 56
HaeIII GGCC 2 cut(s) 90, 117
Hin1II CATG 1 cut(s) 79
HincII GTYRAC 1 cut(s) 54
HindII GTYRAC 1 cut(s) 54
HinfI GANTC 2 cut(s) 4, 72
Hpy166II GTNNAC 1 cut(s) 54
Hpy188III TCNNGA 2 cut(s) 8, 76
Hpy8I GTNNAC 1 cut(s) 54
HpyAV CCTTC 2 cut(s) 74, 167
HpyCH4V TGCA 2 cut(s) 157, 187
HpyF3I CTNAG 1 cut(s) 108
Hsp92II CATG 1 cut(s) 79
LpnPI CCDG 5 cut(s) 20, 47, 98, 112, 116
MaeI CTAG 1 cut(s) 179
MaeIII GTNAC 1 cut(s) 145
MboII GAAGA 1 cut(s) 59
MhlI GDGCHC 1 cut(s) 92
MluCI AATT 1 cut(s) 193
MlyI GAGTC 1 cut(s) 81
MnlI CCTC 3 cut(s) 31, 102, 175
MseI TTAA 1 cut(s) 196
MspR9I CCNGG 1 cut(s) 35
MvaI CCWGG 1 cut(s) 35
NlaIII CATG 1 cut(s) 79
NlaIV GGNNCC 1 cut(s) 90
NmuCI GTSAC 1 cut(s) 145
PagI TCATGA 1 cut(s) 75
PfeI GAWTC 1 cut(s) 4
PleI GAGTC 1 cut(s) 80
PpsI GAGTC 1 cut(s) 80
Psp6I CCWGG 1 cut(s) 33
PspFI CCCAGC 1 cut(s) 112
PspGI CCWGG 1 cut(s) 33
PspN4I GGNNCC 1 cut(s) 90
PspOMI GGGCCC 1 cut(s) 88
PspPI GGNCC 3 cut(s) 88, 89, 115
SaqAI TTAA 1 cut(s) 196
Sau96I GGNCC 3 cut(s) 88, 89, 115
SchI GAGTC 1 cut(s) 81
ScrFI CCNGG 1 cut(s) 35
SduI GDGCHC 1 cut(s) 92
SetI ASST 5 cut(s) 17, 36, 66, 114, 186
SmlI CTYRAG 1 cut(s) 23
SmoI CTYRAG 1 cut(s) 23
Sse9I AATT 1 cut(s) 193
SspMI CTAG 1 cut(s) 179
StyD4I CCNGG 1 cut(s) 33
TaqI TCGA 1 cut(s) 70
TasI AATT 1 cut(s) 193
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 1 cut(s) 196
Tru9I TTAA 1 cut(s) 196
TseFI GTSAC 1 cut(s) 145
Tsp45I GTSAC 1 cut(s) 145
TspDTI ATGAA 1 cut(s) 92
XspI CTAG 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.