RchiOBHm_Chr2g0138741

Late embryogenesis abundant protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Forward (+)
56433384 .. 56434352
969 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 417 bp
ATGTCCCCCCTGACTAGGTGTATCATTTTTTCAATTAATAAAATTCTCTCGCACCAAATCCAAGCCCTACCGAAGGTGGAATCCTGGATCCGCCCCTGTCTCTATTCAGACATTTCTGTTGCAACTGGTCAGTTAAAGAAATACTACCAGCCAAGAAAGAGCTCCCGAACAGTATCAGTGATCTTTGAAGGAACCAAGGTTCCTCTGTATGGGGCTGGATCAAGTTTGAAATACTCTTCGACTGGTGCTTTGGCTCCAATTCCAGTAACTTTAAATTTTGAAATCAAGTCTCGAGGCTACGTCGTTGGACATCTAGTGAAAACCAAGCACATAAGGGCAATCTCATGTCCTTTGGTTATAGATCCCACTGTCACCAAAGCCCTCAAGTTGAAACAGAGTTCATGCACTTACGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00260 ko00630 ko01100 ko01110 ko01130 ko01200 map00260 map00630 map01100 map01110 map01130 map01200
Pfam Domains
Protein Families
LEA_2

Protein Analysis

138

Amino Acids

15.24

Weight (kDa)

9.86

Isoelectric Point (pI)

44.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 91
AclWI GGATC 4 cut(s) 82, 95, 226, 356
AcsI RAATTY 2 cut(s) 42, 274
AfiI CCNNNNNNNGG 3 cut(s) 15, 73, 209
AgsI TTSAA 5 cut(s) 33, 188, 229, 281, 391
AjnI CCWGG 1 cut(s) 83
AloI GAACNNNNNNTCC 4 cut(s) 183, 184, 215, 216
AluBI AGCT 1 cut(s) 162
AluI AGCT 1 cut(s) 162
Alw21I GWGCWC 1 cut(s) 164
Alw26I GTCTC 2 cut(s) 104, 294
AlwI GGATC 4 cut(s) 82, 95, 226, 356
Ama87I CYCGRG 1 cut(s) 291
ApoI RAATTY 2 cut(s) 42, 274
ArsI GACNNNNNNTTYG 2 cut(s) 232, 264
AseI ATTAAT 1 cut(s) 36
AsuHPI GGTGA 1 cut(s) 364
AvaI CYCGRG 1 cut(s) 291
BamHI GGATCC 1 cut(s) 87
BanII GRGCYC 1 cut(s) 164
Bbv12I GWGCWC 1 cut(s) 164
BciT130I CCWGG 1 cut(s) 85
BcoDI GTCTC 2 cut(s) 104, 294
BfaI CTAG 2 cut(s) 15, 314
Bme1390I CCNGG 1 cut(s) 85
BmeT110I CYCGRG 1 cut(s) 291
BmiI GGNNCC 4 cut(s) 89, 193, 201, 255
BmrFI CCNGG 1 cut(s) 85
BpuEI CTTGAG 1 cut(s) 368
BsaJI CCNNGG 1 cut(s) 195
Bsc4I CCNNNNNNNGG 3 cut(s) 15, 73, 209
Bse1I ACTGG 3 cut(s) 130, 247, 263
BseBI CCWGG 1 cut(s) 85
BseDI CCNNGG 1 cut(s) 195
BseLI CCNNNNNNNGG 3 cut(s) 15, 73, 209
BseNI ACTGG 3 cut(s) 130, 247, 263
BsiHKAI GWGCWC 1 cut(s) 164
BsiHKCI CYCGRG 1 cut(s) 291
BslI CCNNNNNNNGG 3 cut(s) 15, 73, 209
BsmAI GTCTC 2 cut(s) 104, 294
BsoBI CYCGRG 1 cut(s) 291
Bsp1286I GDGCHC 1 cut(s) 164
Bsp143I GATC 4 cut(s) 87, 180, 218, 361
BspACI CCGC 1 cut(s) 91
BspLI GGNNCC 4 cut(s) 89, 193, 201, 255
BspPI GGATC 4 cut(s) 82, 95, 226, 356
BsrI ACTGG 3 cut(s) 130, 247, 263
BssECI CCNNGG 1 cut(s) 195
BssMI GATC 4 cut(s) 87, 180, 218, 361
BssT1I CCWWGG 1 cut(s) 195
Bst2UI CCWGG 1 cut(s) 85
Bst4CI ACNGT 2 cut(s) 172, 370
Bst6I CTCTTC 1 cut(s) 241
BstENI CCTNNNNNAGG 1 cut(s) 71
BstKTI GATC 4 cut(s) 90, 183, 221, 364
BstMAI GTCTC 2 cut(s) 104, 294
BstMBI GATC 4 cut(s) 87, 180, 218, 361
BstNI CCWGG 1 cut(s) 85
BstSCI CCNGG 1 cut(s) 83
BstX2I RGATCY 2 cut(s) 87, 361
BstYI RGATCY 2 cut(s) 87, 361
BtsIMutI CAGTG 2 cut(s) 183, 366
CviAII CATG 2 cut(s) 345, 402
CviJI RGCY 7 cut(s) 65, 151, 162, 215, 254, 297, 380
CviKI_1 RGCY 7 cut(s) 65, 151, 162, 215, 254, 297, 380
DpnI GATC 4 cut(s) 89, 182, 220, 363
DpnII GATC 4 cut(s) 87, 180, 218, 361
DraI TTTAAA 1 cut(s) 273
Eam1104I CTCTTC 1 cut(s) 241
EarI CTCTTC 1 cut(s) 241
EciI GGCGGA 1 cut(s) 80
Ecl136II GAGCTC 1 cut(s) 162
Eco130I CCWWGG 1 cut(s) 195
Eco24I GRGCYC 1 cut(s) 164
Eco53kI GAGCTC 1 cut(s) 162
Eco88I CYCGRG 1 cut(s) 291
EcoICRI GAGCTC 1 cut(s) 162
EcoNI CCTNNNNNAGG 1 cut(s) 71
EcoRII CCWGG 1 cut(s) 83
EcoT14I CCWWGG 1 cut(s) 195
EcoT38I GRGCYC 1 cut(s) 164
ErhI CCWWGG 1 cut(s) 195
FaeI CATG 2 cut(s) 348, 405
FaiI YATR 5 cut(s) 210, 332, 346, 359, 403
FatI CATG 2 cut(s) 344, 401
FriOI GRGCYC 1 cut(s) 164
FspBI CTAG 2 cut(s) 15, 314
Hin1II CATG 2 cut(s) 348, 405
HinfI GANTC 1 cut(s) 80
HphI GGTGA 1 cut(s) 364
Hpy188I TCNGA 1 cut(s) 109
Hpy188III TCNNGA 2 cut(s) 165, 291
Hpy99I CGWCG 1 cut(s) 305
HpyAV CCTTC 2 cut(s) 67, 182
HpyCH4III ACNGT 2 cut(s) 172, 370
HpyCH4IV ACGT 1 cut(s) 300
HpyCH4V TGCA 2 cut(s) 122, 405
HpySE526I ACGT 1 cut(s) 300
Hsp92II CATG 2 cut(s) 348, 405
Kzo9I GATC 4 cut(s) 87, 180, 218, 361
LmnI GCTCC 2 cut(s) 167, 259
LpnPI CCDG 9 cut(s) 23, 70, 97, 109, 111, 161, 201, 228, 276
MaeI CTAG 2 cut(s) 15, 314
MaeII ACGT 1 cut(s) 300
MaeIII GTNAC 2 cut(s) 265, 370
MalI GATC 4 cut(s) 89, 182, 220, 363
MboI GATC 4 cut(s) 87, 180, 218, 361
MboII GAAGA 1 cut(s) 228
MflI RGATCY 2 cut(s) 87, 361
MhlI GDGCHC 1 cut(s) 164
MluCI AATT 4 cut(s) 33, 42, 258, 274
MmeI TCCRAC 1 cut(s) 286
MnlI CCTC 3 cut(s) 213, 287, 392
MseI TTAA 3 cut(s) 36, 134, 272
MspR9I CCNGG 1 cut(s) 85
MvaI CCWGG 1 cut(s) 85
NdeII GATC 4 cut(s) 87, 180, 218, 361
NlaIII CATG 2 cut(s) 348, 405
NlaIV GGNNCC 4 cut(s) 89, 193, 201, 255
NmuCI GTSAC 1 cut(s) 370
PaeR7I CTCGAG 1 cut(s) 291
PfeI GAWTC 1 cut(s) 80
PfoI TCCNGGA 1 cut(s) 83
PshBI ATTAAT 1 cut(s) 36
Psp124BI GAGCTC 1 cut(s) 164
Psp6I CCWGG 1 cut(s) 83
PspGI CCWGG 1 cut(s) 83
PspN4I GGNNCC 4 cut(s) 89, 193, 201, 255
PsuI RGATCY 2 cut(s) 87, 361
SacI GAGCTC 1 cut(s) 164
SaqAI TTAA 3 cut(s) 36, 134, 272
Sau3AI GATC 4 cut(s) 87, 180, 218, 361
ScrFI CCNGG 1 cut(s) 85
SduI GDGCHC 1 cut(s) 164
SetI ASST 5 cut(s) 20, 78, 164, 201, 303
Sfr274I CTCGAG 1 cut(s) 291
SlaI CTCGAG 1 cut(s) 291
SmlI CTYRAG 2 cut(s) 291, 383
SmoI CTYRAG 2 cut(s) 291, 383
Sse9I AATT 4 cut(s) 33, 42, 258, 274
SsiI CCGC 1 cut(s) 91
SspMI CTAG 2 cut(s) 15, 314
SstI GAGCTC 1 cut(s) 164
StyD4I CCNGG 1 cut(s) 83
StyI CCWWGG 1 cut(s) 195
TaaI ACNGT 2 cut(s) 172, 370
TaiI ACGT 1 cut(s) 303
TaqI TCGA 2 cut(s) 239, 292
TasI AATT 4 cut(s) 33, 42, 258, 274
TfiI GAWTC 1 cut(s) 80
Tru1I TTAA 3 cut(s) 36, 134, 272
Tru9I TTAA 3 cut(s) 36, 134, 272
TscAI CASTG 2 cut(s) 183, 373
TseFI GTSAC 1 cut(s) 370
Tsp45I GTSAC 1 cut(s) 370
TspDTI ATGAA 1 cut(s) 390
TspRI CASTG 2 cut(s) 183, 373
VspI ATTAAT 1 cut(s) 36
XagI CCTNNNNNAGG 1 cut(s) 71
XapI RAATTY 2 cut(s) 42, 274
XhoI CTCGAG 1 cut(s) 291
XspI CTAG 2 cut(s) 15, 314
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.