RchiOBHm_Chr2g0141081

DNA repair protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Reverse (-)
58650226 .. 58650678
453 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 201 bp
ATGGAATTCAAGCTAATAGAGCTTCCATCATTATTGCAGTACTTGCAAAGCAAGCTGGTCCAAAGCTCACAGACAATGTCAGTAGAAGCTGATAATCATGCCATCTTCTTAAATGTTGTTAGCAGGGTGATGCTGAAAGAAACTGCCAGTGATCTTGCAATAGCCGCAGCAATTTGCAGCAGGCATGTATTTTTACTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.36

Weight (kDa)

6.01

Isoelectric Point (pI)

58.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 165
AcsI RAATTY 1 cut(s) 5
AfaI GTAC 1 cut(s) 41
AgsI TTSAA 1 cut(s) 10
AluBI AGCT 5 cut(s) 13, 22, 55, 66, 89
AluI AGCT 5 cut(s) 13, 22, 55, 66, 89
ApeKI GCWGC 2 cut(s) 167, 177
ApoI RAATTY 1 cut(s) 5
AspS9I GGNCC 1 cut(s) 58
AsuHPI GGTGA 1 cut(s) 139
AvaII GGWCC 1 cut(s) 58
BbvI GCAGC 2 cut(s) 179, 189
BccI CCATC 2 cut(s) 34, 110
BisI GCNGC 3 cut(s) 165, 168, 178
BlsI GCNGC 3 cut(s) 166, 169, 179
BmcAI AGTACT 1 cut(s) 41
Bme18I GGWCC 1 cut(s) 58
BmgT120I GGNCC 1 cut(s) 58
BmsI GCATC 1 cut(s) 120
Bse1I ACTGG 1 cut(s) 147
BseNI ACTGG 1 cut(s) 147
BseXI GCAGC 2 cut(s) 179, 189
Bsp143I GATC 1 cut(s) 151
BspACI CCGC 1 cut(s) 165
BsrI ACTGG 1 cut(s) 147
BssMI GATC 1 cut(s) 151
BstAPI GCANNNNNTGC 1 cut(s) 43
BstC8I GCNNGC 2 cut(s) 53, 182
BstKTI GATC 1 cut(s) 154
BstMBI GATC 1 cut(s) 151
BstMWI GCNNNNNNNGC 4 cut(s) 19, 43, 52, 164
BstNSI RCATGY 1 cut(s) 188
BstV1I GCAGC 2 cut(s) 179, 189
BtsIMutI CAGTG 1 cut(s) 154
Cac8I GCNNGC 2 cut(s) 53, 182
Cfr13I GGNCC 1 cut(s) 58
Csp6I GTAC 1 cut(s) 40
CviAII CATG 2 cut(s) 98, 185
CviJI RGCY 6 cut(s) 13, 22, 55, 66, 89, 164
CviKI_1 RGCY 6 cut(s) 13, 22, 55, 66, 89, 164
CviQI GTAC 1 cut(s) 40
DpnI GATC 1 cut(s) 153
DpnII GATC 1 cut(s) 151
Eco47I GGWCC 1 cut(s) 58
EcoRI GAATTC 1 cut(s) 5
FaeI CATG 2 cut(s) 101, 188
FaiI YATR 2 cut(s) 99, 186
FatI CATG 2 cut(s) 97, 184
Fnu4HI GCNGC 3 cut(s) 165, 168, 178
Fsp4HI GCNGC 3 cut(s) 165, 168, 178
FspEI CC 9 cut(s) 39, 41, 74, 109, 110, 115, 160, 166, 178
GluI GCNGC 3 cut(s) 165, 168, 178
Hin1II CATG 2 cut(s) 101, 188
HphI GGTGA 1 cut(s) 139
HpyCH4V TGCA 4 cut(s) 37, 46, 158, 177
HpyF10VI GCNNNNNNNGC 4 cut(s) 19, 43, 52, 164
Hsp92II CATG 2 cut(s) 101, 188
Kzo9I GATC 1 cut(s) 151
LpnPI CCDG 4 cut(s) 41, 109, 160, 166
Lsp1109I GCAGC 2 cut(s) 179, 189
LweI GCATC 1 cut(s) 120
MalI GATC 1 cut(s) 153
MboI GATC 1 cut(s) 151
MboII GAAGA 1 cut(s) 97
MluCI AATT 2 cut(s) 5, 171
MseI TTAA 1 cut(s) 110
MwoI GCNNNNNNNGC 4 cut(s) 19, 43, 52, 164
NdeII GATC 1 cut(s) 151
NlaIII CATG 2 cut(s) 101, 188
NspI RCATGY 1 cut(s) 188
PflFI GACNNNGTC 1 cut(s) 76
PkrI GCNGC 3 cut(s) 166, 169, 179
PspPI GGNCC 1 cut(s) 58
PsyI GACNNNGTC 1 cut(s) 76
RsaI GTAC 1 cut(s) 41
RsaNI GTAC 1 cut(s) 40
SaqAI TTAA 1 cut(s) 110
SatI GCNGC 3 cut(s) 165, 168, 178
Sau3AI GATC 1 cut(s) 151
Sau96I GGNCC 1 cut(s) 58
ScaI AGTACT 1 cut(s) 41
SetI ASST 5 cut(s) 15, 24, 57, 68, 91
SfaNI GCATC 1 cut(s) 120
SinI GGWCC 1 cut(s) 58
Sse9I AATT 2 cut(s) 5, 171
SsiI CCGC 1 cut(s) 165
TasI AATT 2 cut(s) 5, 171
TatI WGTACW 1 cut(s) 39
TauI GCSGC 1 cut(s) 167
Tru1I TTAA 1 cut(s) 110
Tru9I TTAA 1 cut(s) 110
TscAI CASTG 1 cut(s) 154
TseI GCWGC 2 cut(s) 167, 177
TspRI CASTG 1 cut(s) 154
Tth111I GACNNNGTC 1 cut(s) 76
VpaK11BI GGWCC 1 cut(s) 58
XapI RAATTY 1 cut(s) 5
XceI RCATGY 1 cut(s) 188
ZrmI AGTACT 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.