RchiOBHm_Chr2g0141961

Neprosin

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Reverse (-)
59508117 .. 59508634
518 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 243 bp
ATGTGTGGACACCTGCAACTTAATTACGATACTGACATTAGCCTAGCTCAGATTTGGGTTGTCTCTGGTGCAGGCGAACAACTGAACACTATCGAAGCAGGGTGGATCACTCATTCAGGTCGGAATCAAACAAGGATGTTCTTATACTGGATGGTAAGTTCATTTATTAGTTGGCCTCTTTTTGTTGATCATCTTGATTATAATGCTGATAGGCCAGTAGGTAATGATTACTCCAGAGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

9.24

Weight (kDa)

4.83

Isoelectric Point (pI)

26.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Neprosin PF03080 11 - 51 3e-07 Neprosin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 201
AarI CACCTGC 1 cut(s) 21
Acc36I ACCTGC 1 cut(s) 21
AclWI GGATC 1 cut(s) 113
AloI GAACNNNNNNTCC 2 cut(s) 142, 174
AluBI AGCT 1 cut(s) 47
AluI AGCT 1 cut(s) 47
Alw26I GTCTC 1 cut(s) 67
AlwI GGATC 1 cut(s) 113
AoxI GGCC 2 cut(s) 173, 212
BccI CCATC 1 cut(s) 145
BclI TGATCA 1 cut(s) 187
BcoDI GTCTC 1 cut(s) 67
BfaI CTAG 1 cut(s) 44
BfuAI ACCTGC 1 cut(s) 21
BpmI CTGGAG 1 cut(s) 217
Bse1I ACTGG 2 cut(s) 152, 215
BseGI GGATG 2 cut(s) 141, 156
BseMII CTCAG 1 cut(s) 62
BseNI ACTGG 2 cut(s) 152, 215
BsgI GTGCAG 1 cut(s) 90
BshFI GGCC 2 cut(s) 175, 214
BsmAI GTCTC 1 cut(s) 67
BsnI GGCC 2 cut(s) 175, 214
Bsp143I GATC 2 cut(s) 105, 187
BspANI GGCC 2 cut(s) 175, 214
BspCNI CTCAG 1 cut(s) 61
BspMI ACCTGC 1 cut(s) 21
BspPI GGATC 1 cut(s) 113
BsrI ACTGG 2 cut(s) 152, 215
BssMI GATC 2 cut(s) 105, 187
BstC8I GCNNGC 1 cut(s) 73
BstDEI CTNAG 1 cut(s) 48
BstF5I GGATG 2 cut(s) 141, 156
BstKTI GATC 2 cut(s) 108, 190
BstMAI GTCTC 1 cut(s) 67
BstMBI GATC 2 cut(s) 105, 187
BsuRI GGCC 2 cut(s) 175, 214
BtsCI GGATG 2 cut(s) 141, 156
BveI ACCTGC 1 cut(s) 21
Cac8I GCNNGC 1 cut(s) 73
CviJI RGCY 4 cut(s) 42, 47, 175, 214
CviKI_1 RGCY 4 cut(s) 42, 47, 175, 214
DdeI CTNAG 1 cut(s) 48
DpnI GATC 2 cut(s) 107, 189
DpnII GATC 2 cut(s) 105, 187
FaiI YATR 2 cut(s) 145, 201
FbaI TGATCA 1 cut(s) 187
FokI GGATG 2 cut(s) 148, 163
FspBI CTAG 1 cut(s) 44
GsuI CTGGAG 1 cut(s) 217
HaeIII GGCC 2 cut(s) 175, 214
HinfI GANTC 1 cut(s) 124
Hpy166II GTNNAC 1 cut(s) 8
Hpy188I TCNGA 2 cut(s) 51, 123
Hpy188III TCNNGA 2 cut(s) 194, 234
Hpy8I GTNNAC 1 cut(s) 8
HpyCH4V TGCA 2 cut(s) 16, 71
HpyF3I CTNAG 1 cut(s) 48
Ksp22I TGATCA 1 cut(s) 187
Kzo9I GATC 2 cut(s) 105, 187
LpnPI CCDG 7 cut(s) 26, 51, 57, 84, 102, 133, 228
MaeI CTAG 1 cut(s) 44
MalI GATC 2 cut(s) 107, 189
MboI GATC 2 cut(s) 105, 187
MluCI AATT 1 cut(s) 22
MmeI TCCRAC 1 cut(s) 101
MnlI CCTC 1 cut(s) 186
MseI TTAA 1 cut(s) 21
NdeII GATC 2 cut(s) 105, 187
PaqCI CACCTGC 1 cut(s) 21
PfeI GAWTC 1 cut(s) 124
PsiI TTATAA 1 cut(s) 201
SaqAI TTAA 1 cut(s) 21
Sau3AI GATC 2 cut(s) 105, 187
SetI ASST 4 cut(s) 15, 49, 121, 223
Sse9I AATT 1 cut(s) 22
SspMI CTAG 1 cut(s) 44
TaqI TCGA 1 cut(s) 93
TasI AATT 1 cut(s) 22
TfiI GAWTC 1 cut(s) 124
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
TspDTI ATGAA 1 cut(s) 150
XspI CTAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.