RchiOBHm_Chr2g0142031

Reverse transcriptase (RNA-dependent DNA polymerase)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Reverse (-)
59556311 .. 59556546
236 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 153 bp
ATGATGGACTTGAGCTGCGAATTGTCTATTCATAGTATCAAAAATAGCTTCTTCGCTATTGGCAGTTTGAAGGCTCCAGGTACTGATGGTATTTCTGCTAGTTTCTTTCGAAGACAATTAAATGTGTGGGTGATACTTTGGCTTCTGTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.63

Weight (kDa)

7.98

Isoelectric Point (pI)

39.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 82
AgsI TTSAA 1 cut(s) 70
AjnI CCWGG 1 cut(s) 76
AluBI AGCT 2 cut(s) 15, 48
AluI AGCT 2 cut(s) 15, 48
AlwNI CAGNNNCTG 1 cut(s) 83
ApeKI GCWGC 1 cut(s) 15
AsuHPI GGTGA 1 cut(s) 142
AsuII TTCGAA 1 cut(s) 109
BbsI GAAGAC 1 cut(s) 118
BbvI GCAGC 1 cut(s) 2
BccI CCATC 1 cut(s) 80
BciT130I CCWGG 1 cut(s) 78
BfaI CTAG 1 cut(s) 99
BisI GCNGC 1 cut(s) 16
BlsI GCNGC 1 cut(s) 17
Bme1390I CCNGG 1 cut(s) 78
BmiI GGNNCC 1 cut(s) 75
BmrFI CCNGG 1 cut(s) 78
BpiI GAAGAC 1 cut(s) 118
BpmI CTGGAG 1 cut(s) 60
Bpu14I TTCGAA 1 cut(s) 109
BpuEI CTTGAG 1 cut(s) 31
BseBI CCWGG 1 cut(s) 78
BseXI GCAGC 1 cut(s) 2
Bsp119I TTCGAA 1 cut(s) 109
BspLI GGNNCC 1 cut(s) 75
BspT104I TTCGAA 1 cut(s) 109
Bst2UI CCWGG 1 cut(s) 78
BstBI TTCGAA 1 cut(s) 109
BstNI CCWGG 1 cut(s) 78
BstSCI CCNGG 1 cut(s) 76
BstV1I GCAGC 1 cut(s) 2
BstV2I GAAGAC 1 cut(s) 118
CaiI CAGNNNCTG 1 cut(s) 83
Csp6I GTAC 1 cut(s) 81
CviJI RGCY 4 cut(s) 15, 48, 74, 142
CviKI_1 RGCY 4 cut(s) 15, 48, 74, 142
CviQI GTAC 1 cut(s) 81
EcoRII CCWGG 1 cut(s) 76
FaiI YATR 1 cut(s) 33
Fnu4HI GCNGC 1 cut(s) 16
Fsp4HI GCNGC 1 cut(s) 16
FspBI CTAG 1 cut(s) 99
FspEI CC 8 cut(s) 45, 56, 63, 72, 90, 112, 113, 124
GluI GCNGC 1 cut(s) 16
GsuI CTGGAG 1 cut(s) 60
HphI GGTGA 1 cut(s) 142
HpyAV CCTTC 1 cut(s) 64
LmnI GCTCC 1 cut(s) 79
LpnPI CCDG 2 cut(s) 63, 90
Lsp1109I GCAGC 1 cut(s) 2
MaeI CTAG 1 cut(s) 99
MboII GAAGA 2 cut(s) 43, 123
MluCI AATT 2 cut(s) 20, 116
MseI TTAA 1 cut(s) 119
MspR9I CCNGG 1 cut(s) 78
MvaI CCWGG 1 cut(s) 78
NlaIV GGNNCC 1 cut(s) 75
NspV TTCGAA 1 cut(s) 109
PkrI GCNGC 1 cut(s) 17
Psp6I CCWGG 1 cut(s) 76
PspGI CCWGG 1 cut(s) 76
PspN4I GGNNCC 1 cut(s) 75
PstNI CAGNNNCTG 1 cut(s) 83
RsaI GTAC 1 cut(s) 82
RsaNI GTAC 1 cut(s) 81
SaqAI TTAA 1 cut(s) 119
SatI GCNGC 1 cut(s) 16
ScrFI CCNGG 1 cut(s) 78
SetI ASST 3 cut(s) 17, 50, 82
SfuI TTCGAA 1 cut(s) 109
SgeI CNNG 4 cut(s) 22, 89, 90, 111
SmlI CTYRAG 1 cut(s) 10
SmoI CTYRAG 1 cut(s) 10
Sse9I AATT 2 cut(s) 20, 116
SspMI CTAG 1 cut(s) 99
StyD4I CCNGG 1 cut(s) 76
TaqI TCGA 1 cut(s) 109
TasI AATT 2 cut(s) 20, 116
Tru1I TTAA 1 cut(s) 119
Tru9I TTAA 1 cut(s) 119
TseI GCWGC 1 cut(s) 15
TspDTI ATGAA 1 cut(s) 20
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.