RchiOBHm_Chr2g0147481

tRNA pseudouridine synthase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Reverse (-)
65077228 .. 65078943
1716 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 165 bp
ATGGGTTGGAGGTGGACAAGATTGACATTTGAGATTGTGGTTTCATATCGTGGTGGTTCCTTTGATGGGTGGCAAAACCAGTTGGACCTCTACACTATCCAAAGGATTATGTGCCTACATTGTTTGACAACATCAGTGCTAATTTGGTGGCGGATGCATAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

6.59

Weight (kDa)

8.89

Isoelectric Point (pI)

41.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 151
AfiI CCNNNNNNNGG 1 cut(s) 66
AspS9I GGNCC 1 cut(s) 85
AvaII GGWCC 1 cut(s) 85
BccI CCATC 1 cut(s) 59
Bme18I GGWCC 1 cut(s) 85
BmgT120I GGNCC 1 cut(s) 85
BmiI GGNNCC 1 cut(s) 58
BmsI GCATC 1 cut(s) 144
Bsc4I CCNNNNNNNGG 1 cut(s) 66
Bse1I ACTGG 1 cut(s) 79
BseGI GGATG 1 cut(s) 159
BseLI CCNNNNNNNGG 1 cut(s) 66
BseNI ACTGG 1 cut(s) 79
BslI CCNNNNNNNGG 1 cut(s) 66
BspACI CCGC 1 cut(s) 151
BspLI GGNNCC 1 cut(s) 58
BsrI ACTGG 1 cut(s) 79
BstF5I GGATG 1 cut(s) 159
BtsCI GGATG 1 cut(s) 159
BtsIMutI CAGTG 1 cut(s) 141
Cfr13I GGNCC 1 cut(s) 85
Eco47I GGWCC 1 cut(s) 85
EcoT22I ATGCAT 1 cut(s) 159
FaiI YATR 3 cut(s) 46, 110, 159
Hpy166II GTNNAC 1 cut(s) 15
Hpy8I GTNNAC 1 cut(s) 15
HpyCH4V TGCA 1 cut(s) 157
LpnPI CCDG 1 cut(s) 92
LweI GCATC 1 cut(s) 144
MluCI AATT 1 cut(s) 141
MmeI TCCRAC 1 cut(s) 63
MnlI CCTC 2 cut(s) 3, 98
Mph1103I ATGCAT 1 cut(s) 159
MseI TTAA 1 cut(s) 163
NlaIV GGNNCC 1 cut(s) 58
NsiI ATGCAT 1 cut(s) 159
PspN4I GGNNCC 1 cut(s) 58
PspPI GGNCC 1 cut(s) 85
SaqAI TTAA 1 cut(s) 163
Sau96I GGNCC 1 cut(s) 85
SetI ASST 2 cut(s) 14, 90
SfaNI GCATC 1 cut(s) 144
SgeI CNNG 3 cut(s) 30, 62, 91
SinI GGWCC 1 cut(s) 85
Sse9I AATT 1 cut(s) 141
SsiI CCGC 1 cut(s) 151
TasI AATT 1 cut(s) 141
Tru1I TTAA 1 cut(s) 163
Tru9I TTAA 1 cut(s) 163
TscAI CASTG 1 cut(s) 141
TspDTI ATGAA 1 cut(s) 33
TspRI CASTG 1 cut(s) 141
VpaK11BI GGWCC 1 cut(s) 85
Zsp2I ATGCAT 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.