RchiOBHm_Chr2g0148041

gamma-irradiation and mitomycin c induced

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Reverse (-)
65636819 .. 65638360
1542 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 273 bp
ATGATATTAGCTCAGTACTTAGGTAAAGATCATATGCTTCCTATTGTCTCTAGATCTTTTGAAGCTGCTGGTGCTTTTGAGGACTTTGTAGAGAGTGATTATGGGGAAGTTGATTGTATCCATCCACTCTGTGAACCAGCTGTGAACCAACTCTGCTTTACAGTCCTACACATGGTTGATCTTTTATTCTATGTCTGGAAGATATCAAGTAACATAAAACACTTCCTAATTACAATTGTTCTAGGATCTAGGGGACTGAAAAATGCTCTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.14

Weight (kDa)

5.36

Isoelectric Point (pI)

27.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 253
AdeI CACNNNGTG 1 cut(s) 131
AfaI GTAC 1 cut(s) 17
AfiI CCNNNNNNNGG 1 cut(s) 172
AgsI TTSAA 1 cut(s) 62
AluBI AGCT 3 cut(s) 11, 65, 140
AluI AGCT 3 cut(s) 11, 65, 140
Alw26I GTCTC 1 cut(s) 52
AlwI GGATC 1 cut(s) 253
ApeKI GCWGC 1 cut(s) 65
BbvI GCAGC 1 cut(s) 52
BccI CCATC 1 cut(s) 129
BciVI GTATCC 1 cut(s) 128
BcoDI GTCTC 1 cut(s) 52
BfaI CTAG 3 cut(s) 51, 242, 249
BfuI GTATCC 1 cut(s) 128
BglII AGATCT 1 cut(s) 53
BisI GCNGC 1 cut(s) 66
BlsI GCNGC 1 cut(s) 67
BmcAI AGTACT 1 cut(s) 17
Bsc4I CCNNNNNNNGG 1 cut(s) 172
BseGI GGATG 1 cut(s) 121
BseLI CCNNNNNNNGG 1 cut(s) 172
BseMII CTCAG 1 cut(s) 26
BseXI GCAGC 1 cut(s) 52
BslFI GGGAC 1 cut(s) 267
BslI CCNNNNNNNGG 1 cut(s) 172
BsmAI GTCTC 1 cut(s) 52
BsmFI GGGAC 1 cut(s) 267
Bsp143I GATC 4 cut(s) 28, 53, 178, 245
BspCNI CTCAG 1 cut(s) 25
BspPI GGATC 1 cut(s) 253
BssMI GATC 4 cut(s) 28, 53, 178, 245
Bst4CI ACNGT 1 cut(s) 163
BstDEI CTNAG 2 cut(s) 12, 19
BstF5I GGATG 1 cut(s) 121
BstKTI GATC 4 cut(s) 31, 56, 181, 248
BstMAI GTCTC 1 cut(s) 52
BstMBI GATC 4 cut(s) 28, 53, 178, 245
BstMWI GCNNNNNNNGC 1 cut(s) 71
BstV1I GCAGC 1 cut(s) 52
BstX2I RGATCY 2 cut(s) 53, 245
BstYI RGATCY 2 cut(s) 53, 245
BsuI GTATCC 1 cut(s) 128
BtsCI GGATG 1 cut(s) 121
Csp6I GTAC 1 cut(s) 16
CviAII CATG 1 cut(s) 172
CviJI RGCY 3 cut(s) 11, 65, 140
CviKI_1 RGCY 3 cut(s) 11, 65, 140
CviQI GTAC 1 cut(s) 16
DdeI CTNAG 2 cut(s) 12, 19
DpnI GATC 4 cut(s) 30, 55, 180, 247
DpnII GATC 4 cut(s) 28, 53, 178, 245
DraIII CACNNNGTG 1 cut(s) 131
Eco32I GATATC 1 cut(s) 204
EcoRV GATATC 1 cut(s) 204
FaeI CATG 1 cut(s) 175
FaiI YATR 7 cut(s) 33, 35, 102, 173, 192, 215, 271
FaqI GGGAC 1 cut(s) 267
FatI CATG 1 cut(s) 171
FauNDI CATATG 1 cut(s) 33
Fnu4HI GCNGC 1 cut(s) 66
FokI GGATG 1 cut(s) 108
Fsp4HI GCNGC 1 cut(s) 66
FspBI CTAG 3 cut(s) 51, 242, 249
GluI GCNGC 1 cut(s) 66
Hin1II CATG 1 cut(s) 175
Hpy166II GTNNAC 2 cut(s) 134, 145
Hpy188III TCNNGA 2 cut(s) 51, 196
Hpy8I GTNNAC 2 cut(s) 134, 145
HpyCH4III ACNGT 1 cut(s) 163
HpyF10VI GCNNNNNNNGC 1 cut(s) 71
HpyF3I CTNAG 2 cut(s) 12, 19
Hsp92II CATG 1 cut(s) 175
Kzo9I GATC 4 cut(s) 28, 53, 178, 245
LpnPI CCDG 3 cut(s) 54, 150, 181
Lsp1109I GCAGC 1 cut(s) 52
MaeI CTAG 3 cut(s) 51, 242, 249
MaeIII GTNAC 1 cut(s) 209
MalI GATC 4 cut(s) 30, 55, 180, 247
MboI GATC 4 cut(s) 28, 53, 178, 245
MboII GAAGA 1 cut(s) 211
MfeI CAATTG 1 cut(s) 234
MflI RGATCY 2 cut(s) 53, 245
MluCI AATT 2 cut(s) 228, 234
MnlI CCTC 1 cut(s) 73
MspA1I CMGCKG 1 cut(s) 140
MunI CAATTG 1 cut(s) 234
MwoI GCNNNNNNNGC 1 cut(s) 71
NdeI CATATG 1 cut(s) 33
NdeII GATC 4 cut(s) 28, 53, 178, 245
NlaIII CATG 1 cut(s) 175
PkrI GCNGC 1 cut(s) 67
PsuI RGATCY 2 cut(s) 53, 245
PvuII CAGCTG 1 cut(s) 140
RsaI GTAC 1 cut(s) 17
RsaNI GTAC 1 cut(s) 16
SatI GCNGC 1 cut(s) 66
Sau3AI GATC 4 cut(s) 28, 53, 178, 245
ScaI AGTACT 1 cut(s) 17
SetI ASST 4 cut(s) 13, 25, 67, 142
SgeI CNNG 8 cut(s) 63, 81, 149, 184, 208, 219, 254, 261
Sse9I AATT 2 cut(s) 228, 234
SspMI CTAG 3 cut(s) 51, 242, 249
TaaI ACNGT 1 cut(s) 163
TasI AATT 2 cut(s) 228, 234
TatI WGTACW 1 cut(s) 15
TseI GCWGC 1 cut(s) 65
XbaI TCTAGA 1 cut(s) 50
XspI CTAG 3 cut(s) 51, 242, 249
ZrmI AGTACT 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.