RchiOBHm_Chr2g0150361

Ribosomal protein TL5, C-terminal domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Forward (+)
68040773 .. 68041383
611 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 351 bp
ATGACAACCCTAAAATGTATGCCCTCAAAGATTTGTCCTTCATTTTCTTCACTAAGCCAAGCCATGTTCCCAACCGGAAACCGAATCTCAGCGAAAGACACAGTCCAGTGGCGAATCCCCACCGTCATGTTCGCCAAGCCGGCCCCCGGCAGATCCATCTCCAAAAAGCACTTGCTGACTTTGGAAAGGAAGAAGATTCAGGCCACTCTCAAGTCACATGTCCCCGTATATCTGCTATTTCACCGCTCTAGATCCGACCCGGGTTTGGGTCGTCGGTTCTGCTTGAATCCGGAAACGTCCTACCCGTCAAGATTCAAAGAGATGAAGAGATTGAATTTGGTGTTTGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L25p Ribosomal_TL5_C

Protein Analysis

116

Amino Acids

13.27

Weight (kDa)

10.85

Isoelectric Point (pI)

52.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 246
AccIII TCCGGA 1 cut(s) 289
AciI CCGC 1 cut(s) 244
AclWI GGATC 2 cut(s) 147, 246
AcsI RAATTY 1 cut(s) 334
AfiI CCNNNNNNNGG 3 cut(s) 146, 265, 266
AflIII ACRYGT 1 cut(s) 217
AgsI TTSAA 3 cut(s) 286, 316, 334
AlwI GGATC 2 cut(s) 147, 246
Ama87I CYCGRG 1 cut(s) 259
Aor13HI TCCGGA 1 cut(s) 289
AoxI GGCC 2 cut(s) 141, 201
ApoI RAATTY 1 cut(s) 334
AspS9I GGNCC 1 cut(s) 142
AsuC2I CCSGG 3 cut(s) 147, 260, 261
AsuHPI GGTGA 1 cut(s) 233
AvaI CYCGRG 1 cut(s) 259
BccI CCATC 1 cut(s) 164
BcnI CCSGG 3 cut(s) 147, 260, 261
BfaI CTAG 1 cut(s) 249
BglI GCCNNNNNGGC 1 cut(s) 140
Bme1390I CCNGG 3 cut(s) 147, 260, 261
BmeT110I CYCGRG 1 cut(s) 259
BmgT120I GGNCC 1 cut(s) 142
BmiI GGNNCC 1 cut(s) 144
BmrFI CCNGG 3 cut(s) 147, 260, 261
BpuEI CTTGAG 1 cut(s) 194
BpuMI CCSGG 3 cut(s) 147, 260, 261
BsaJI CCNNGG 2 cut(s) 145, 259
BsaWI WCCGGW 2 cut(s) 74, 289
Bsc4I CCNNNNNNNGG 3 cut(s) 146, 265, 266
Bse118I RCCGGY 1 cut(s) 139
Bse1I ACTGG 1 cut(s) 106
BseAI TCCGGA 1 cut(s) 289
BseDI CCNNGG 2 cut(s) 145, 259
BseLI CCNNNNNNNGG 3 cut(s) 146, 265, 266
BseMII CTCAG 1 cut(s) 102
BseNI ACTGG 1 cut(s) 106
BshFI GGCC 2 cut(s) 143, 203
BsiHKCI CYCGRG 1 cut(s) 259
BsiSI CCGG 5 cut(s) 75, 140, 147, 260, 290
BslFI GGGAC 1 cut(s) 206
BslI CCNNNNNNNGG 3 cut(s) 146, 265, 266
BsmFI GGGAC 1 cut(s) 206
BsnI GGCC 2 cut(s) 143, 203
BsoBI CYCGRG 1 cut(s) 259
Bsp13I TCCGGA 1 cut(s) 289
Bsp143I GATC 2 cut(s) 152, 251
BspACI CCGC 1 cut(s) 244
BspANI GGCC 2 cut(s) 143, 203
BspCNI CTCAG 1 cut(s) 101
BspEI TCCGGA 1 cut(s) 289
BspLI GGNNCC 1 cut(s) 144
BspPI GGATC 2 cut(s) 147, 246
BsrBI CCGCTC 1 cut(s) 246
BsrFI RCCGGY 1 cut(s) 139
BsrI ACTGG 1 cut(s) 106
BssAI RCCGGY 1 cut(s) 139
BssECI CCNNGG 2 cut(s) 145, 259
BssMI GATC 2 cut(s) 152, 251
Bst4CI ACNGT 2 cut(s) 103, 124
Bst6I CTCTTC 1 cut(s) 320
BstC8I GCNNGC 1 cut(s) 141
BstDEI CTNAG 2 cut(s) 53, 88
BstKTI GATC 2 cut(s) 155, 254
BstMBI GATC 2 cut(s) 152, 251
BstMWI GCNNNNNNNGC 1 cut(s) 140
BstNSI RCATGY 1 cut(s) 221
BstSCI CCNGG 3 cut(s) 145, 258, 259
BstX2I RGATCY 2 cut(s) 152, 251
BstYI RGATCY 2 cut(s) 152, 251
BsuRI GGCC 2 cut(s) 143, 203
BtsIMutI CAGTG 1 cut(s) 113
Cac8I GCNNGC 1 cut(s) 141
Cfr10I RCCGGY 1 cut(s) 139
Cfr13I GGNCC 1 cut(s) 142
Cfr9I CCCGGG 1 cut(s) 259
CviAII CATG 3 cut(s) 64, 127, 218
CviJI RGCY 5 cut(s) 57, 62, 139, 143, 203
CviKI_1 RGCY 5 cut(s) 57, 62, 139, 143, 203
DdeI CTNAG 2 cut(s) 53, 88
DpnI GATC 2 cut(s) 154, 253
DpnII GATC 2 cut(s) 152, 251
Eam1104I CTCTTC 1 cut(s) 320
EarI CTCTTC 1 cut(s) 320
Eco88I CYCGRG 1 cut(s) 259
FaeI CATG 3 cut(s) 67, 130, 221
FaiI YATR 5 cut(s) 20, 65, 128, 219, 229
FaqI GGGAC 1 cut(s) 206
FatI CATG 3 cut(s) 63, 126, 217
FspBI CTAG 1 cut(s) 249
HaeIII GGCC 2 cut(s) 143, 203
HapII CCGG 5 cut(s) 75, 140, 147, 260, 290
Hin1II CATG 3 cut(s) 67, 130, 221
HinfI GANTC 5 cut(s) 84, 114, 196, 286, 312
HpaII CCGG 5 cut(s) 75, 140, 147, 260, 290
HphI GGTGA 1 cut(s) 233
Hpy188I TCNGA 1 cut(s) 256
Hpy188III TCNNGA 3 cut(s) 249, 290, 309
Hpy99I CGWCG 1 cut(s) 276
HpyAV CCTTC 1 cut(s) 48
HpyCH4III ACNGT 2 cut(s) 103, 124
HpyCH4IV ACGT 1 cut(s) 296
HpyF10VI GCNNNNNNNGC 1 cut(s) 140
HpyF3I CTNAG 2 cut(s) 53, 88
HpySE526I ACGT 1 cut(s) 296
Hsp92II CATG 3 cut(s) 67, 130, 221
Kpn2I TCCGGA 1 cut(s) 289
KroI GCCGGC 1 cut(s) 139
KroNI GCCGGC 1 cut(s) 141
Kzo9I GATC 2 cut(s) 152, 251
LpnPI CCDG 7 cut(s) 88, 119, 153, 160, 185, 273, 303
MaeI CTAG 1 cut(s) 249
MaeII ACGT 1 cut(s) 296
MaeIII GTNAC 1 cut(s) 213
MalI GATC 2 cut(s) 154, 253
MbiI CCGCTC 1 cut(s) 246
MboI GATC 2 cut(s) 152, 251
MboII GAAGA 4 cut(s) 39, 202, 205, 337
MflI RGATCY 2 cut(s) 152, 251
MluCI AATT 1 cut(s) 334
MmeI TCCRAC 1 cut(s) 279
MnlI CCTC 1 cut(s) 34
MroI TCCGGA 1 cut(s) 289
MroNI GCCGGC 1 cut(s) 139
MslI CAYNNNNRTG 1 cut(s) 125
MspI CCGG 5 cut(s) 75, 140, 147, 260, 290
MspR9I CCNGG 3 cut(s) 147, 260, 261
MwoI GCNNNNNNNGC 1 cut(s) 140
NaeI GCCGGC 1 cut(s) 141
NciI CCSGG 3 cut(s) 147, 260, 261
NdeII GATC 2 cut(s) 152, 251
NgoMIV GCCGGC 1 cut(s) 139
NlaIII CATG 3 cut(s) 67, 130, 221
NlaIV GGNNCC 1 cut(s) 144
NmuCI GTSAC 1 cut(s) 213
NspI RCATGY 1 cut(s) 221
PciI ACATGT 1 cut(s) 217
PcsI WCGNNNNNNNCGW 1 cut(s) 302
PdiI GCCGGC 1 cut(s) 141
PfeI GAWTC 5 cut(s) 84, 114, 196, 286, 312
PflFI GACNNNGTC 1 cut(s) 101
PscI ACATGT 1 cut(s) 217
PspN4I GGNNCC 1 cut(s) 144
PspPI GGNCC 1 cut(s) 142
PsuI RGATCY 2 cut(s) 152, 251
PsyI GACNNNGTC 1 cut(s) 101
RseI CAYNNNNRTG 1 cut(s) 125
Sau3AI GATC 2 cut(s) 152, 251
Sau96I GGNCC 1 cut(s) 142
ScrFI CCNGG 3 cut(s) 147, 260, 261
SetI ASST 1 cut(s) 299
SmaI CCCGGG 1 cut(s) 261
SmiMI CAYNNNNRTG 1 cut(s) 125
SmlI CTYRAG 1 cut(s) 209
SmoI CTYRAG 1 cut(s) 209
Sse9I AATT 1 cut(s) 334
SsiI CCGC 1 cut(s) 244
SspMI CTAG 1 cut(s) 249
StyD4I CCNGG 3 cut(s) 145, 258, 259
TaaI ACNGT 2 cut(s) 103, 124
TaiI ACGT 1 cut(s) 299
TasI AATT 1 cut(s) 334
TfiI GAWTC 5 cut(s) 84, 114, 196, 286, 312
TscAI CASTG 1 cut(s) 113
TseFI GTSAC 1 cut(s) 213
Tsp45I GTSAC 1 cut(s) 213
TspDTI ATGAA 2 cut(s) 30, 338
TspMI CCCGGG 1 cut(s) 259
TspRI CASTG 1 cut(s) 113
Tth111I GACNNNGTC 1 cut(s) 101
XapI RAATTY 1 cut(s) 334
XbaI TCTAGA 1 cut(s) 248
XceI RCATGY 1 cut(s) 221
XmaI CCCGGG 1 cut(s) 259
XspI CTAG 1 cut(s) 249
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.