RchiOBHm_Chr2g0152891

wall-associated receptor kinase-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Reverse (-)
70260398 .. 70260634
237 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 237 bp
ATGTTAGAAGACGGGAGAATTGTTGCTTTGAAGAAGTCTAAAATAGTTGATGAAAGCCAACTTTCAAAATTCATCAATGAGGTTGTCATTCTTTCCCAAATTAACCATAGAAATGTGGTTCAACTATTGGGTTGTTGTTTAGAGACAGAAGTTCCTATTTTGGTTTATAAATTTATACCAAATGAAACCCTTTCCAAGTATATCACAAAGCAAGTTGAAGACTTCACACTCACATGA

Protein Analysis

78

Amino Acids

8.94

Weight (kDa)

5.73

Isoelectric Point (pI)

29.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 3 - 71 3.7e-08 Protein kinase domain
PK_Tyr_Ser-Thr PF07714 6 - 76 2.1e-11 Protein tyrosine and serine/threonine kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 168
AcsI RAATTY 2 cut(s) 68, 170
AgsI TTSAA 4 cut(s) 31, 66, 122, 218
Alw26I GTCTC 1 cut(s) 137
ApoI RAATTY 2 cut(s) 68, 170
BbsI GAAGAC 2 cut(s) 15, 225
BcoDI GTCTC 1 cut(s) 137
BpiI GAAGAC 2 cut(s) 15, 225
BsmAI GTCTC 1 cut(s) 137
BstMAI GTCTC 1 cut(s) 137
BstV2I GAAGAC 2 cut(s) 15, 225
CviAII CATG 1 cut(s) 234
CviJI RGCY 1 cut(s) 57
CviKI_1 RGCY 1 cut(s) 57
FaeI CATG 1 cut(s) 237
FaiI YATR 5 cut(s) 108, 168, 176, 201, 235
FatI CATG 1 cut(s) 233
Hin1II CATG 1 cut(s) 237
Hsp92II CATG 1 cut(s) 237
MboII GAAGA 3 cut(s) 20, 43, 230
MluCI AATT 4 cut(s) 18, 68, 99, 170
MnlI CCTC 1 cut(s) 73
MseI TTAA 1 cut(s) 102
MslI CAYNNNNRTG 2 cut(s) 111, 232
NlaIII CATG 1 cut(s) 237
PsiI TTATAA 1 cut(s) 168
RseI CAYNNNNRTG 2 cut(s) 111, 232
SaqAI TTAA 1 cut(s) 102
SetI ASST 1 cut(s) 84
SgeI CNNG 3 cut(s) 25, 208, 224
SmiMI CAYNNNNRTG 2 cut(s) 111, 232
Sse9I AATT 4 cut(s) 18, 68, 99, 170
TasI AATT 4 cut(s) 18, 68, 99, 170
Tru1I TTAA 1 cut(s) 102
Tru9I TTAA 1 cut(s) 102
TspDTI ATGAA 3 cut(s) 61, 66, 198
XapI RAATTY 2 cut(s) 68, 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.