RchiOBHm_Chr2g0153241

Belongs to the UDP-glycosyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Forward (+)
70648035 .. 70648196
162 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 162 bp
ATGCTCGGGCTAGTATTCCATTTCCAAGTGCAGCGCGATCAATATAGCAAGGATTACATCGAGTTTAAAGACTCAGACGCTGAGTTGCTCATCCTGAGTTTTGTCAATCCCTTGCCAGCTGCTGTCTTACCTGACATGCTATTAGTGAAGAAGGTAACATAA

Protein Analysis

53

Amino Acids

6.1

Weight (kDa)

4.94

Isoelectric Point (pI)

22.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 36
AluBI AGCT 1 cut(s) 119
AluI AGCT 1 cut(s) 119
AlwNI CAGNNNCTG 2 cut(s) 80, 122
Ama87I CYCGRG 1 cut(s) 5
ApeKI GCWGC 2 cut(s) 31, 119
AspLEI GCGC 1 cut(s) 36
AvaI CYCGRG 1 cut(s) 5
BbvI GCAGC 2 cut(s) 43, 106
BfaI CTAG 1 cut(s) 11
BisI GCNGC 2 cut(s) 32, 120
BlsI GCNGC 2 cut(s) 33, 121
BmeT110I CYCGRG 1 cut(s) 5
BseGI GGATG 1 cut(s) 90
BseMII CTCAG 3 cut(s) 72, 86, 87
BseXI GCAGC 2 cut(s) 43, 106
BsgI GTGCAG 1 cut(s) 50
Bsh1236I CGCG 1 cut(s) 36
BsiHKCI CYCGRG 1 cut(s) 5
BsoBI CYCGRG 1 cut(s) 5
Bsp143I GATC 1 cut(s) 37
BspCNI CTCAG 3 cut(s) 73, 86, 87
BspFNI CGCG 1 cut(s) 36
BssMI GATC 1 cut(s) 37
BstC8I GCNNGC 1 cut(s) 117
BstDEI CTNAG 3 cut(s) 73, 81, 95
BstF5I GGATG 1 cut(s) 90
BstFNI CGCG 1 cut(s) 36
BstHHI GCGC 1 cut(s) 36
BstKTI GATC 1 cut(s) 40
BstMBI GATC 1 cut(s) 37
BstNSI RCATGY 1 cut(s) 139
BstUI CGCG 1 cut(s) 36
BstV1I GCAGC 2 cut(s) 43, 106
BtsCI GGATG 1 cut(s) 90
Cac8I GCNNGC 1 cut(s) 117
CaiI CAGNNNCTG 2 cut(s) 80, 122
CfoI GCGC 1 cut(s) 36
CseI GACGC 1 cut(s) 86
CviAII CATG 1 cut(s) 136
CviJI RGCY 2 cut(s) 10, 119
CviKI_1 RGCY 2 cut(s) 10, 119
DdeI CTNAG 3 cut(s) 73, 81, 95
DpnI GATC 1 cut(s) 39
DpnII GATC 1 cut(s) 37
DraI TTTAAA 1 cut(s) 67
Eco88I CYCGRG 1 cut(s) 5
FaeI CATG 1 cut(s) 139
FaiI YATR 3 cut(s) 45, 137, 160
FatI CATG 1 cut(s) 135
Fnu4HI GCNGC 2 cut(s) 32, 120
FokI GGATG 1 cut(s) 77
Fsp4HI GCNGC 2 cut(s) 32, 120
FspBI CTAG 1 cut(s) 11
FspEI CC 9 cut(s) 32, 35, 38, 107, 123, 124, 129, 137, 144
GlaI GCGC 1 cut(s) 35
GluI GCNGC 2 cut(s) 32, 120
HgaI GACGC 1 cut(s) 86
HhaI GCGC 1 cut(s) 36
Hin1II CATG 1 cut(s) 139
Hin6I GCGC 1 cut(s) 34
HinP1I GCGC 1 cut(s) 34
HinfI GANTC 1 cut(s) 71
Hpy188I TCNGA 1 cut(s) 76
Hpy188III TCNNGA 1 cut(s) 94
HpyAV CCTTC 1 cut(s) 145
HpyCH4V TGCA 1 cut(s) 31
HpyF3I CTNAG 3 cut(s) 73, 81, 95
Hsp92II CATG 1 cut(s) 139
HspAI GCGC 1 cut(s) 34
Kzo9I GATC 1 cut(s) 37
LpnPI CCDG 3 cut(s) 107, 129, 144
Lsp1109I GCAGC 2 cut(s) 43, 106
MaeI CTAG 1 cut(s) 11
MaeIII GTNAC 1 cut(s) 154
MalI GATC 1 cut(s) 39
MboI GATC 1 cut(s) 37
MboII GAAGA 1 cut(s) 160
MlyI GAGTC 1 cut(s) 65
MseI TTAA 1 cut(s) 66
MspA1I CMGCKG 1 cut(s) 119
MvnI CGCG 1 cut(s) 36
NdeII GATC 1 cut(s) 37
NlaIII CATG 1 cut(s) 139
NspI RCATGY 1 cut(s) 139
PkrI GCNGC 2 cut(s) 33, 121
PleI GAGTC 1 cut(s) 65
PpsI GAGTC 1 cut(s) 65
PstNI CAGNNNCTG 2 cut(s) 80, 122
PvuII CAGCTG 1 cut(s) 119
SaqAI TTAA 1 cut(s) 66
SatI GCNGC 2 cut(s) 32, 120
Sau3AI GATC 1 cut(s) 37
SchI GAGTC 1 cut(s) 65
SetI ASST 3 cut(s) 121, 133, 156
SspMI CTAG 1 cut(s) 11
TaqI TCGA 1 cut(s) 60
Tru1I TTAA 1 cut(s) 66
Tru9I TTAA 1 cut(s) 66
TseI GCWGC 2 cut(s) 31, 119
XceI RCATGY 1 cut(s) 139
XspI CTAG 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.