RchiOBHm_Chr2g0154251

UDP-Glycosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Reverse (-)
71448052 .. 71448300
249 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 249 bp
ATGGCTTCGGATAAGCCTCATGCTGTTTGTATTCCAGCTCCATCTCAAAGCCACATAAAGGGTGTGCTCAAGTTTGCAAAACTCCTACACCACAGAGGTTTTTATGTCACTTTTGTCAACACAGAGTTCAATCACAAGCGTTTTCTGAAATCTCTAGGCCCTGACTCCTTAGATGGCATCGCTGATTTTCGGTTTCAAACCATTCGGATGGCCTTCCCGATTCTGATCCTGATGCCAATCAAGACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.31

Weight (kDa)

10.01

Isoelectric Point (pI)

46.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 220
AfiI CCNNNNNNNGG 1 cut(s) 58
AgsI TTSAA 2 cut(s) 130, 197
AluBI AGCT 1 cut(s) 38
AluI AGCT 1 cut(s) 38
Alw21I GWGCWC 1 cut(s) 69
AlwI GGATC 1 cut(s) 220
AoxI GGCC 2 cut(s) 157, 210
AspS9I GGNCC 1 cut(s) 158
Bbv12I GWGCWC 1 cut(s) 69
BccI CCATC 3 cut(s) 49, 167, 202
BfaI CTAG 1 cut(s) 155
BmgT120I GGNCC 1 cut(s) 158
BmsI GCATC 2 cut(s) 186, 222
BpuEI CTTGAG 1 cut(s) 53
BsaBI GATNNNNATC 2 cut(s) 224, 236
Bsc4I CCNNNNNNNGG 1 cut(s) 58
Bse8I GATNNNNATC 2 cut(s) 224, 236
BseGI GGATG 1 cut(s) 213
BseJI GATNNNNATC 2 cut(s) 224, 236
BseLI CCNNNNNNNGG 1 cut(s) 58
BshFI GGCC 2 cut(s) 159, 212
BsiHKAI GWGCWC 1 cut(s) 69
BslI CCNNNNNNNGG 1 cut(s) 58
BsnI GGCC 2 cut(s) 159, 212
Bsp1286I GDGCHC 1 cut(s) 69
Bsp143I GATC 1 cut(s) 225
BspANI GGCC 2 cut(s) 159, 212
BspPI GGATC 1 cut(s) 220
BssMI GATC 1 cut(s) 225
BstDEI CTNAG 1 cut(s) 169
BstF5I GGATG 1 cut(s) 213
BstKTI GATC 1 cut(s) 228
BstMBI GATC 1 cut(s) 225
BstXI CCANNNNNNTGG 1 cut(s) 208
BsuRI GGCC 2 cut(s) 159, 212
BtgZI GCGATG 1 cut(s) 163
BtsCI GGATG 1 cut(s) 213
Cfr13I GGNCC 1 cut(s) 158
CviAII CATG 1 cut(s) 20
CviJI RGCY 6 cut(s) 5, 16, 38, 51, 159, 212
CviKI_1 RGCY 6 cut(s) 5, 16, 38, 51, 159, 212
DdeI CTNAG 1 cut(s) 169
DpnI GATC 1 cut(s) 227
DpnII GATC 1 cut(s) 225
EcoO109I RGGNCCY 1 cut(s) 158
FaeI CATG 1 cut(s) 23
FaiI YATR 3 cut(s) 21, 56, 105
FatI CATG 1 cut(s) 19
FokI GGATG 1 cut(s) 220
FspBI CTAG 1 cut(s) 155
HaeIII GGCC 2 cut(s) 159, 212
Hin1II CATG 1 cut(s) 23
HincII GTYRAC 1 cut(s) 118
HindII GTYRAC 1 cut(s) 118
HinfI GANTC 2 cut(s) 164, 220
Hpy166II GTNNAC 1 cut(s) 118
Hpy188I TCNGA 4 cut(s) 10, 147, 207, 225
Hpy188III TCNNGA 3 cut(s) 217, 229, 241
Hpy8I GTNNAC 1 cut(s) 118
HpyAV CCTTC 1 cut(s) 223
HpyCH4V TGCA 1 cut(s) 77
HpyF3I CTNAG 1 cut(s) 169
Hsp92II CATG 1 cut(s) 23
Kzo9I GATC 1 cut(s) 225
LmnI GCTCC 1 cut(s) 43
LpnPI CCDG 3 cut(s) 48, 174, 242
LweI GCATC 2 cut(s) 186, 222
MaeI CTAG 1 cut(s) 155
MaeIII GTNAC 1 cut(s) 106
MalI GATC 1 cut(s) 227
MboI GATC 1 cut(s) 225
MhlI GDGCHC 1 cut(s) 69
MlyI GAGTC 1 cut(s) 158
MnlI CCTC 2 cut(s) 27, 89
MslI CAYNNNNRTG 1 cut(s) 206
NdeII GATC 1 cut(s) 225
NlaIII CATG 1 cut(s) 23
NmuCI GTSAC 1 cut(s) 106
PfeI GAWTC 1 cut(s) 220
PleI GAGTC 1 cut(s) 158
PpsI GAGTC 1 cut(s) 158
PspPI GGNCC 1 cut(s) 158
RseI CAYNNNNRTG 1 cut(s) 206
Sau3AI GATC 1 cut(s) 225
Sau96I GGNCC 1 cut(s) 158
SchI GAGTC 1 cut(s) 158
SduI GDGCHC 1 cut(s) 69
SetI ASST 2 cut(s) 40, 100
SfaNI GCATC 2 cut(s) 186, 222
SgeI CNNG 8 cut(s) 32, 47, 82, 148, 167, 173, 229, 241
SmiMI CAYNNNNRTG 1 cut(s) 206
SmlI CTYRAG 1 cut(s) 68
SmoI CTYRAG 1 cut(s) 68
SspMI CTAG 1 cut(s) 155
TfiI GAWTC 1 cut(s) 220
TseFI GTSAC 1 cut(s) 106
Tsp45I GTSAC 1 cut(s) 106
XspI CTAG 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.