RchiOBHm_Chr2g0156511

Palmitoyl-monogalactosyldiacylglycerol delta-7 desaturase, chloroplastic-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Reverse (-)
73117772 .. 73118066
295 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 189 bp
ATGGTATATGTTTACCACATAACTTTTTCAATAAATTCTATTTGCCACAAATGGAGAAAGCAAGTTTGGGAGAGTGGTGATTCGTCTAAAAACAATTGGTTGTTTGGGTTGCTAGCTCATGGAGAAGGATGGCACAACAACCACCATGCATTTGAGTACTCAGCTCGGCAAGGCCTGGAGTGGTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.49

Weight (kDa)

7.01

Isoelectric Point (pI)

45.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 34
AfaI GTAC 1 cut(s) 158
AgsI TTSAA 1 cut(s) 30
AjnI CCWGG 1 cut(s) 174
AjuI GAANNNNNNNTTGG 2 cut(s) 49, 81
AluBI AGCT 2 cut(s) 116, 164
AluI AGCT 2 cut(s) 116, 164
AoxI GGCC 1 cut(s) 172
ApoI RAATTY 1 cut(s) 34
AsuHPI GGTGA 1 cut(s) 89
AsuNHI GCTAGC 1 cut(s) 112
BccI CCATC 1 cut(s) 123
BciT130I CCWGG 1 cut(s) 176
BfaI CTAG 1 cut(s) 113
BmcAI AGTACT 1 cut(s) 158
Bme1390I CCNGG 1 cut(s) 176
BmrFI CCNGG 1 cut(s) 176
BmtI GCTAGC 1 cut(s) 116
BsaXI ACNNNNNCTCC 1 cut(s) 170
BseBI CCWGG 1 cut(s) 176
BseGI GGATG 1 cut(s) 134
BseMII CTCAG 1 cut(s) 174
BshFI GGCC 1 cut(s) 174
BsnI GGCC 1 cut(s) 174
BspANI GGCC 1 cut(s) 174
BspCNI CTCAG 1 cut(s) 173
BspOI GCTAGC 1 cut(s) 116
Bst2UI CCWGG 1 cut(s) 176
BstC8I GCNNGC 1 cut(s) 114
BstDEI CTNAG 1 cut(s) 160
BstF5I GGATG 1 cut(s) 134
BstNI CCWGG 1 cut(s) 176
BstSCI CCNGG 1 cut(s) 174
BsuRI GGCC 1 cut(s) 174
BtsCI GGATG 1 cut(s) 134
Cac8I GCNNGC 1 cut(s) 114
Csp6I GTAC 1 cut(s) 157
CviAII CATG 2 cut(s) 119, 146
CviJI RGCY 3 cut(s) 116, 164, 174
CviKI_1 RGCY 3 cut(s) 116, 164, 174
CviQI GTAC 1 cut(s) 157
DdeI CTNAG 1 cut(s) 160
Eco147I AGGCCT 1 cut(s) 174
EcoRII CCWGG 1 cut(s) 174
EcoT22I ATGCAT 1 cut(s) 151
FaeI CATG 2 cut(s) 122, 149
FaiI YATR 5 cut(s) 7, 9, 20, 120, 147
FatI CATG 2 cut(s) 118, 145
FokI GGATG 1 cut(s) 141
FspBI CTAG 1 cut(s) 113
HaeIII GGCC 1 cut(s) 174
Hin1II CATG 2 cut(s) 122, 149
HinfI GANTC 1 cut(s) 80
HphI GGTGA 1 cut(s) 89
Hpy166II GTNNAC 1 cut(s) 13
Hpy8I GTNNAC 1 cut(s) 13
HpyAV CCTTC 1 cut(s) 119
HpyCH4V TGCA 1 cut(s) 149
HpyF3I CTNAG 1 cut(s) 160
Hsp92II CATG 2 cut(s) 122, 149
LpnPI CCDG 1 cut(s) 161
MaeI CTAG 1 cut(s) 113
MfeI CAATTG 1 cut(s) 94
MluCI AATT 2 cut(s) 34, 94
Mph1103I ATGCAT 1 cut(s) 151
MspR9I CCNGG 1 cut(s) 176
MunI CAATTG 1 cut(s) 94
MvaI CCWGG 1 cut(s) 176
NheI GCTAGC 1 cut(s) 112
NlaIII CATG 2 cut(s) 122, 149
NmeAIII GCCGAG 1 cut(s) 145
NsiI ATGCAT 1 cut(s) 151
PceI AGGCCT 1 cut(s) 174
PfeI GAWTC 1 cut(s) 80
Psp6I CCWGG 1 cut(s) 174
PspGI CCWGG 1 cut(s) 174
RsaI GTAC 1 cut(s) 158
RsaNI GTAC 1 cut(s) 157
ScaI AGTACT 1 cut(s) 158
ScrFI CCNGG 1 cut(s) 176
SetI ASST 2 cut(s) 118, 166
SgeI CNNG 6 cut(s) 74, 125, 131, 158, 177, 182
Sse9I AATT 2 cut(s) 34, 94
SseBI AGGCCT 1 cut(s) 174
SspMI CTAG 1 cut(s) 113
StuI AGGCCT 1 cut(s) 174
StyD4I CCNGG 1 cut(s) 174
TasI AATT 2 cut(s) 34, 94
TatI WGTACW 1 cut(s) 156
TfiI GAWTC 1 cut(s) 80
XapI RAATTY 1 cut(s) 34
XspI CTAG 1 cut(s) 113
ZrmI AGTACT 1 cut(s) 158
Zsp2I ATGCAT 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.