RchiOBHm_Chr2g0156991

Endoglucanase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Reverse (-)
73491490 .. 73491657
168 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 168 bp
ATGATGAGTATATTAATCTTGTTGATAGTATCATCACTAGGGATGTTGGCAATGGCAACATTCACAAGCTCTGTAAGGCATTCACAAAACTACTCGGATGCTTTGTTGAAGAGTATTTTGTTTTTCGAAGGACAGAGGTCGGAAGGTTACGGCCCACCCAATGAGTGA
Functional Annotation

Protein Analysis

55

Amino Acids

6.05

Weight (kDa)

5.61

Isoelectric Point (pI)

55.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 109
AluBI AGCT 1 cut(s) 69
AluI AGCT 1 cut(s) 69
AoxI GGCC 1 cut(s) 151
AseI ATTAAT 1 cut(s) 14
AspS9I GGNCC 1 cut(s) 152
AsuII TTCGAA 1 cut(s) 126
BceAI ACGGC 1 cut(s) 166
BfaI CTAG 1 cut(s) 38
BmgT120I GGNCC 1 cut(s) 152
BmsI GCATC 1 cut(s) 88
BoxI GACNNNNGTC 1 cut(s) 136
Bpu14I TTCGAA 1 cut(s) 126
Bse3DI GCAATG 1 cut(s) 57
BseGI GGATG 2 cut(s) 48, 103
BseMI GCAATG 1 cut(s) 57
BshFI GGCC 1 cut(s) 153
BsmI GAATGC 1 cut(s) 79
BsnI GGCC 1 cut(s) 153
Bsp119I TTCGAA 1 cut(s) 126
BspANI GGCC 1 cut(s) 153
BspT104I TTCGAA 1 cut(s) 126
BsrDI GCAATG 1 cut(s) 57
Bst6I CTCTTC 1 cut(s) 104
BstBI TTCGAA 1 cut(s) 126
BstF5I GGATG 2 cut(s) 48, 103
BstPAI GACNNNNGTC 1 cut(s) 136
BsuRI GGCC 1 cut(s) 153
BtsCI GGATG 2 cut(s) 48, 103
Cfr13I GGNCC 1 cut(s) 152
CviJI RGCY 2 cut(s) 69, 153
CviKI_1 RGCY 2 cut(s) 69, 153
Eam1104I CTCTTC 1 cut(s) 104
EarI CTCTTC 1 cut(s) 104
FaiI YATR 1 cut(s) 11
FokI GGATG 2 cut(s) 55, 110
FspBI CTAG 1 cut(s) 38
HaeIII GGCC 1 cut(s) 153
Hpy188I TCNGA 2 cut(s) 97, 142
HpyAV CCTTC 2 cut(s) 122, 137
LweI GCATC 1 cut(s) 88
MaeI CTAG 1 cut(s) 38
MaeIII GTNAC 1 cut(s) 146
MboII GAAGA 1 cut(s) 121
MmeI TCCRAC 1 cut(s) 120
MnlI CCTC 1 cut(s) 129
MseI TTAA 1 cut(s) 14
Mva1269I GAATGC 1 cut(s) 79
NspV TTCGAA 1 cut(s) 126
PctI GAATGC 1 cut(s) 79
PshAI GACNNNNGTC 1 cut(s) 136
PshBI ATTAAT 1 cut(s) 14
PspPI GGNCC 1 cut(s) 152
SaqAI TTAA 1 cut(s) 14
Sau96I GGNCC 1 cut(s) 152
SetI ASST 3 cut(s) 71, 140, 148
SfaNI GCATC 1 cut(s) 88
SfuI TTCGAA 1 cut(s) 126
SgeI CNNG 4 cut(s) 31, 50, 78, 106
SspMI CTAG 1 cut(s) 38
TaqI TCGA 1 cut(s) 126
Tru1I TTAA 1 cut(s) 14
Tru9I TTAA 1 cut(s) 14
VspI ATTAAT 1 cut(s) 14
XspI CTAG 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.