RchiOBHm_Chr2g0158091

Helicase conserved C-terminal domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Forward (+)
74486885 .. 74489331
2447 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 135 bp
ATGGTAGATGAAGCTCATGAAAGGTCTATCTCCACGGACATTTTATTGGGTCTCCTGAAAAAGTTAGGCCGTATTATATACTTTTTGAATCTGAAAATTTCTAGATCCAAAAACGCCGGCCTGAGCTGCGCCTGA

Protein Analysis

44

Amino Acids

4.89

Weight (kDa)

9.51

Isoelectric Point (pI)

32.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 99
AcsI RAATTY 1 cut(s) 96
AgsI TTSAA 1 cut(s) 88
AluBI AGCT 2 cut(s) 14, 126
AluI AGCT 2 cut(s) 14, 126
Alw26I GTCTC 1 cut(s) 56
AlwI GGATC 1 cut(s) 99
AoxI GGCC 2 cut(s) 67, 118
ApeKI GCWGC 1 cut(s) 126
ApoI RAATTY 1 cut(s) 96
AspLEI GCGC 1 cut(s) 131
BbvI GCAGC 1 cut(s) 113
BceAI ACGGC 1 cut(s) 54
BcoDI GTCTC 1 cut(s) 56
BfaI CTAG 1 cut(s) 102
BisI GCNGC 1 cut(s) 127
BlsI GCNGC 1 cut(s) 128
Bpu10I CCTNAGC 1 cut(s) 122
BsaI GGTCTC 1 cut(s) 56
BsaJI CCNNGG 1 cut(s) 33
Bse118I RCCGGY 1 cut(s) 116
BseDI CCNNGG 1 cut(s) 33
BseMII CTCAG 1 cut(s) 113
BseXI GCAGC 1 cut(s) 113
BshFI GGCC 2 cut(s) 69, 120
BsiSI CCGG 1 cut(s) 117
BsmAI GTCTC 1 cut(s) 56
BsnI GGCC 2 cut(s) 69, 120
Bso31I GGTCTC 1 cut(s) 56
Bsp143I GATC 1 cut(s) 104
BspANI GGCC 2 cut(s) 69, 120
BspCNI CTCAG 1 cut(s) 114
BspHI TCATGA 1 cut(s) 16
BspPI GGATC 1 cut(s) 99
BspTNI GGTCTC 1 cut(s) 56
BsrFI RCCGGY 1 cut(s) 116
BssAI RCCGGY 1 cut(s) 116
BssECI CCNNGG 1 cut(s) 33
BssMI GATC 1 cut(s) 104
BstC8I GCNNGC 1 cut(s) 118
BstDEI CTNAG 1 cut(s) 122
BstDSI CCRYGG 1 cut(s) 33
BstHHI GCGC 1 cut(s) 131
BstKTI GATC 1 cut(s) 107
BstMAI GTCTC 1 cut(s) 56
BstMBI GATC 1 cut(s) 104
BstMWI GCNNNNNNNGC 1 cut(s) 126
BstV1I GCAGC 1 cut(s) 113
BstX2I RGATCY 1 cut(s) 104
BstYI RGATCY 1 cut(s) 104
BsuRI GGCC 2 cut(s) 69, 120
BtgI CCRYGG 1 cut(s) 33
Cac8I GCNNGC 1 cut(s) 118
CciI TCATGA 1 cut(s) 16
CfoI GCGC 1 cut(s) 131
Cfr10I RCCGGY 1 cut(s) 116
CviAII CATG 1 cut(s) 17
CviJI RGCY 4 cut(s) 14, 69, 120, 126
CviKI_1 RGCY 4 cut(s) 14, 69, 120, 126
DdeI CTNAG 1 cut(s) 122
DpnI GATC 1 cut(s) 106
DpnII GATC 1 cut(s) 104
Eco31I GGTCTC 1 cut(s) 56
FaeI CATG 1 cut(s) 20
FaiI YATR 3 cut(s) 18, 77, 79
FatI CATG 1 cut(s) 16
Fnu4HI GCNGC 1 cut(s) 127
Fsp4HI GCNGC 1 cut(s) 127
FspBI CTAG 1 cut(s) 102
GlaI GCGC 1 cut(s) 130
GluI GCNGC 1 cut(s) 127
HaeIII GGCC 2 cut(s) 69, 120
HapII CCGG 1 cut(s) 117
HhaI GCGC 1 cut(s) 131
Hin1II CATG 1 cut(s) 20
Hin6I GCGC 1 cut(s) 129
HinP1I GCGC 1 cut(s) 129
HinfI GANTC 1 cut(s) 88
HpaII CCGG 1 cut(s) 117
Hpy188I TCNGA 1 cut(s) 93
Hpy188III TCNNGA 3 cut(s) 17, 55, 102
HpyF10VI GCNNNNNNNGC 1 cut(s) 126
HpyF3I CTNAG 1 cut(s) 122
Hsp92II CATG 1 cut(s) 20
HspAI GCGC 1 cut(s) 129
KroI GCCGGC 1 cut(s) 116
KroNI GCCGGC 1 cut(s) 118
Kzo9I GATC 1 cut(s) 104
LpnPI CCDG 2 cut(s) 68, 130
Lsp1109I GCAGC 1 cut(s) 113
MaeI CTAG 1 cut(s) 102
MalI GATC 1 cut(s) 106
MboI GATC 1 cut(s) 104
MflI RGATCY 1 cut(s) 104
MluCI AATT 1 cut(s) 96
MroNI GCCGGC 1 cut(s) 116
MspI CCGG 1 cut(s) 117
MwoI GCNNNNNNNGC 1 cut(s) 126
NaeI GCCGGC 1 cut(s) 118
NdeII GATC 1 cut(s) 104
NgoMIV GCCGGC 1 cut(s) 116
NlaIII CATG 1 cut(s) 20
PagI TCATGA 1 cut(s) 16
PdiI GCCGGC 1 cut(s) 118
PfeI GAWTC 1 cut(s) 88
PkrI GCNGC 1 cut(s) 128
PsuI RGATCY 1 cut(s) 104
SatI GCNGC 1 cut(s) 127
Sau3AI GATC 1 cut(s) 104
SetI ASST 3 cut(s) 16, 26, 128
SgeI CNNG 5 cut(s) 29, 46, 67, 114, 129
Sse9I AATT 1 cut(s) 96
SspMI CTAG 1 cut(s) 102
TasI AATT 1 cut(s) 96
TfiI GAWTC 1 cut(s) 88
TseI GCWGC 1 cut(s) 126
TspDTI ATGAA 2 cut(s) 24, 33
TspGWI ACGGA 1 cut(s) 50
XapI RAATTY 1 cut(s) 96
XbaI TCTAGA 1 cut(s) 101
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.