RchiOBHm_Chr2g0165971

UDP-glycosyltransferase 83A1-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Forward (+)
80822099 .. 80822800
702 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 210 bp
ATGCAATTCCGGTGCTCTCATATATTTTGGAAAGGGAATCAAGTTACAGATGCTGAGGGTAACAGATGGGCTCTGGAAGTAGCAGAGAAAATGCAAATAAAGAAAGTTGCCTTCTGGCCTATGTCAGCTACACTTTTCGCACTGGAGTTTTGTATCCCAAAATTAATTCAAGAAGGAATCATTGATGATGATGGTGACACGCATTGCTGA
Functional Annotation

Protein Analysis

69

Amino Acids

7.96

Weight (kDa)

5.13

Isoelectric Point (pI)

17.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 170
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
Alw21I GWGCWC 1 cut(s) 17
AlwNI CAGNNNCTG 1 cut(s) 53
AoxI GGCC 1 cut(s) 116
AseI ATTAAT 1 cut(s) 164
AsuHPI GGTGA 1 cut(s) 206
BanII GRGCYC 1 cut(s) 73
Bbv12I GWGCWC 1 cut(s) 17
BbvCI CCTCAGC 1 cut(s) 54
BccI CCATC 2 cut(s) 60, 185
BciVI GTATCC 1 cut(s) 164
BfuI GTATCC 1 cut(s) 164
BmsI GCATC 1 cut(s) 40
BpmI CTGGAG 1 cut(s) 164
Bpu10I CCTNAGC 1 cut(s) 54
BsaWI WCCGGW 1 cut(s) 9
Bse1I ACTGG 1 cut(s) 147
Bse3DI GCAATG 1 cut(s) 202
BseMI GCAATG 1 cut(s) 202
BseMII CTCAG 1 cut(s) 45
BseNI ACTGG 1 cut(s) 147
BshFI GGCC 1 cut(s) 118
BsiHKAI GWGCWC 1 cut(s) 17
BsiSI CCGG 1 cut(s) 10
BsnI GGCC 1 cut(s) 118
Bsp1286I GDGCHC 2 cut(s) 17, 73
BspANI GGCC 1 cut(s) 118
BspCNI CTCAG 1 cut(s) 46
BsrDI GCAATG 1 cut(s) 202
BsrI ACTGG 1 cut(s) 147
BstDEI CTNAG 1 cut(s) 54
BsuI GTATCC 1 cut(s) 164
BsuRI GGCC 1 cut(s) 118
BtsIMutI CAGTG 1 cut(s) 140
CaiI CAGNNNCTG 1 cut(s) 53
CviJI RGCY 3 cut(s) 71, 118, 128
CviKI_1 RGCY 3 cut(s) 71, 118, 128
DdeI CTNAG 1 cut(s) 54
Eco24I GRGCYC 1 cut(s) 73
EcoT38I GRGCYC 1 cut(s) 73
FaiI YATR 3 cut(s) 21, 23, 122
FriOI GRGCYC 1 cut(s) 73
GsuI CTGGAG 1 cut(s) 164
HaeIII GGCC 1 cut(s) 118
HapII CCGG 1 cut(s) 10
HinfI GANTC 2 cut(s) 37, 177
HpaII CCGG 1 cut(s) 10
HphI GGTGA 1 cut(s) 206
Hpy188III TCNNGA 2 cut(s) 74, 170
HpyAV CCTTC 2 cut(s) 121, 167
HpyCH4V TGCA 2 cut(s) 4, 94
HpyF3I CTNAG 1 cut(s) 54
LpnPI CCDG 4 cut(s) 23, 59, 100, 128
LweI GCATC 1 cut(s) 40
MaeIII GTNAC 3 cut(s) 43, 59, 194
MhlI GDGCHC 2 cut(s) 17, 73
MluCI AATT 3 cut(s) 5, 161, 165
MnlI CCTC 1 cut(s) 49
MseI TTAA 1 cut(s) 164
MspI CCGG 1 cut(s) 10
NmuCI GTSAC 1 cut(s) 194
PfeI GAWTC 2 cut(s) 37, 177
PshBI ATTAAT 1 cut(s) 164
PstNI CAGNNNCTG 1 cut(s) 53
SaqAI TTAA 1 cut(s) 164
SduI GDGCHC 2 cut(s) 17, 73
SetI ASST 1 cut(s) 130
SfaNI GCATC 1 cut(s) 40
SgeI CNNG 6 cut(s) 22, 53, 86, 127, 155, 182
Sse9I AATT 3 cut(s) 5, 161, 165
TasI AATT 3 cut(s) 5, 161, 165
TfiI GAWTC 2 cut(s) 37, 177
Tru1I TTAA 1 cut(s) 164
Tru9I TTAA 1 cut(s) 164
TscAI CASTG 1 cut(s) 147
TseFI GTSAC 1 cut(s) 194
Tsp45I GTSAC 1 cut(s) 194
TspRI CASTG 1 cut(s) 147
VspI ATTAAT 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.