RchiOBHm_Chr2g0171761

Protein farnesyltransferase subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Reverse (-)
85327611 .. 85328595
985 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 207 bp
ATGTGTCCCCTTTCTAGTGAATTGCAATTGGATATGAATTTTATCAACAGAAGAGTAGAAATGAAGCCACTTTTCCATGCCATTGCATTGAAGCGGTTTTATGCACATAGGTTAGCGGAGAATAATGGTGGACTGATAGACAAACCTGGCAAATCTAGAGATTTTTATCACACATGTTTTGGGTCAAAATATGTGGTCGGACGCTGA

Protein Analysis

68

Amino Acids

7.89

Weight (kDa)

9.62

Isoelectric Point (pI)

40.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Prenyltrans PF00432 22 - 61 4.8e-07 Prenyltransferase alpha-alpha toroid domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 94, 116
AcsI RAATTY 1 cut(s) 37
AflIII ACRYGT 1 cut(s) 173
AgsI TTSAA 1 cut(s) 91
AjnI CCWGG 1 cut(s) 145
ApoI RAATTY 1 cut(s) 37
BciT130I CCWGG 1 cut(s) 147
BfaI CTAG 2 cut(s) 15, 156
Bme1390I CCNGG 1 cut(s) 147
BmrFI CCNGG 1 cut(s) 147
BsaBI GATNNNNATC 1 cut(s) 165
Bse3DI GCAATG 1 cut(s) 81
Bse8I GATNNNNATC 1 cut(s) 165
BseBI CCWGG 1 cut(s) 147
BseJI GATNNNNATC 1 cut(s) 165
BseMI GCAATG 1 cut(s) 81
BspACI CCGC 2 cut(s) 94, 116
BsrDI GCAATG 1 cut(s) 81
Bst2UI CCWGG 1 cut(s) 147
Bst6I CTCTTC 1 cut(s) 46
BstNI CCWGG 1 cut(s) 147
BstNSI RCATGY 1 cut(s) 177
BstSCI CCNGG 1 cut(s) 145
CspCI CAANNNNNGTGG 1 cut(s) 174
CviAII CATG 2 cut(s) 77, 174
CviJI RGCY 1 cut(s) 67
CviKI_1 RGCY 1 cut(s) 67
Eam1104I CTCTTC 1 cut(s) 46
EarI CTCTTC 1 cut(s) 46
EcoRII CCWGG 1 cut(s) 145
FaeI CATG 2 cut(s) 80, 177
FaiI YATR 6 cut(s) 35, 78, 102, 108, 175, 192
FatI CATG 2 cut(s) 76, 173
FspBI CTAG 2 cut(s) 15, 156
Hin1II CATG 2 cut(s) 80, 177
Hpy166II GTNNAC 1 cut(s) 131
Hpy188I TCNGA 1 cut(s) 200
Hpy188III TCNNGA 1 cut(s) 156
Hpy8I GTNNAC 1 cut(s) 131
HpyCH4V TGCA 3 cut(s) 25, 86, 104
Hsp92II CATG 2 cut(s) 80, 177
LpnPI CCDG 2 cut(s) 132, 159
MaeI CTAG 2 cut(s) 15, 156
MboII GAAGA 1 cut(s) 63
MfeI CAATTG 1 cut(s) 26
MluCI AATT 3 cut(s) 20, 26, 37
MmeI TCCRAC 1 cut(s) 178
MspR9I CCNGG 1 cut(s) 147
MunI CAATTG 1 cut(s) 26
MvaI CCWGG 1 cut(s) 147
NlaIII CATG 2 cut(s) 80, 177
NspI RCATGY 1 cut(s) 177
PciI ACATGT 1 cut(s) 173
PscI ACATGT 1 cut(s) 173
Psp6I CCWGG 1 cut(s) 145
PspGI CCWGG 1 cut(s) 145
ScrFI CCNGG 1 cut(s) 147
SetI ASST 2 cut(s) 113, 148
SgeI CNNG 6 cut(s) 27, 89, 158, 159, 168, 186
Sse9I AATT 3 cut(s) 20, 26, 37
SsiI CCGC 2 cut(s) 94, 116
SspMI CTAG 2 cut(s) 15, 156
StyD4I CCNGG 1 cut(s) 145
TasI AATT 3 cut(s) 20, 26, 37
TspDTI ATGAA 2 cut(s) 50, 77
XapI RAATTY 1 cut(s) 37
XbaI TCTAGA 1 cut(s) 155
XceI RCATGY 1 cut(s) 177
XspI CTAG 2 cut(s) 15, 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.