RchiOBHm_Chr2g0174271

Cystinosin homolog

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Reverse (-)
86909009 .. 86910056
1048 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 270 bp
ATGTTCATGATACCTGTAGCTGCAAATGATGTTGCTTTCTCTGTTCATGCCGCTTTTGTAACATCAATTATCCTTCTCCAAATTGCAATCTATGAAGTAACGAGGAAGTCAGAAAGTATCCAAGATTGCCATTGGAATCGTCTTTGGTGTGTGGCTATTTGCTGCAGTTTGGTTCTTGGTCTGCCAACTCATTCTTGGCTTTGGCTCATCTCAATCTTCAACTCAATTCAAGTTTTTATGACAGTCATCAAATATACTCCCCAGGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

10.14

Weight (kDa)

6.8

Isoelectric Point (pI)

33.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 51
AgsI TTSAA 2 cut(s) 220, 230
AjnI CCWGG 1 cut(s) 261
AluBI AGCT 1 cut(s) 20
AluI AGCT 1 cut(s) 20
ApeKI GCWGC 2 cut(s) 20, 162
BbvI GCAGC 2 cut(s) 7, 149
BciT130I CCWGG 1 cut(s) 263
BciVI GTATCC 1 cut(s) 128
BfmI CTRYAG 2 cut(s) 15, 163
BfuI GTATCC 1 cut(s) 128
BisI GCNGC 3 cut(s) 21, 51, 163
BlsI GCNGC 3 cut(s) 22, 52, 164
Bme1390I CCNGG 1 cut(s) 263
BmrFI CCNGG 1 cut(s) 263
BsaJI CCNNGG 1 cut(s) 261
BseBI CCWGG 1 cut(s) 263
BseDI CCNNGG 1 cut(s) 261
BseXI GCAGC 2 cut(s) 7, 149
BspACI CCGC 1 cut(s) 51
BspHI TCATGA 1 cut(s) 6
BspMAI CTGCAG 1 cut(s) 167
BssECI CCNNGG 1 cut(s) 261
Bst2UI CCWGG 1 cut(s) 263
Bst4CI ACNGT 1 cut(s) 244
BstNI CCWGG 1 cut(s) 263
BstSCI CCNGG 1 cut(s) 261
BstSFI CTRYAG 2 cut(s) 15, 163
BstV1I GCAGC 2 cut(s) 7, 149
BsuI GTATCC 1 cut(s) 128
CciI TCATGA 1 cut(s) 6
CviAII CATG 2 cut(s) 7, 47
CviJI RGCY 4 cut(s) 20, 155, 199, 205
CviKI_1 RGCY 4 cut(s) 20, 155, 199, 205
EcoRII CCWGG 1 cut(s) 261
FaeI CATG 2 cut(s) 10, 50
FaiI YATR 5 cut(s) 8, 48, 93, 239, 255
FatI CATG 2 cut(s) 6, 46
Fnu4HI GCNGC 3 cut(s) 21, 51, 163
Fsp4HI GCNGC 3 cut(s) 21, 51, 163
GluI GCNGC 3 cut(s) 21, 51, 163
Hin1II CATG 2 cut(s) 10, 50
HinfI GANTC 1 cut(s) 136
Hpy188I TCNGA 1 cut(s) 112
Hpy188III TCNNGA 1 cut(s) 7
HpyAV CCTTC 1 cut(s) 83
HpyCH4III ACNGT 1 cut(s) 244
HpyCH4V TGCA 3 cut(s) 23, 86, 165
Hsp92II CATG 2 cut(s) 10, 50
LpnPI CCDG 2 cut(s) 27, 248
Lsp1109I GCAGC 2 cut(s) 7, 149
MaeIII GTNAC 2 cut(s) 58, 97
MboII GAAGA 1 cut(s) 208
MluCI AATT 3 cut(s) 66, 81, 225
MnlI CCTC 1 cut(s) 96
MspR9I CCNGG 1 cut(s) 263
MvaI CCWGG 1 cut(s) 263
NlaIII CATG 2 cut(s) 10, 50
PagI TCATGA 1 cut(s) 6
PfeI GAWTC 1 cut(s) 136
PkrI GCNGC 3 cut(s) 22, 52, 164
Psp6I CCWGG 1 cut(s) 261
PspGI CCWGG 1 cut(s) 261
PstI CTGCAG 1 cut(s) 167
SatI GCNGC 3 cut(s) 21, 51, 163
ScrFI CCNGG 1 cut(s) 263
SetI ASST 3 cut(s) 16, 22, 267
SfcI CTRYAG 2 cut(s) 15, 163
SgeI CNNG 8 cut(s) 19, 26, 59, 114, 134, 188, 207, 242
Sse9I AATT 3 cut(s) 66, 81, 225
SsiI CCGC 1 cut(s) 51
StyD4I CCNGG 1 cut(s) 261
TaaI ACNGT 1 cut(s) 244
TasI AATT 3 cut(s) 66, 81, 225
TauI GCSGC 1 cut(s) 53
TfiI GAWTC 1 cut(s) 136
TseI GCWGC 2 cut(s) 20, 162
TspDTI ATGAA 2 cut(s) 35, 108
XcmI CCANNNNNNNNNTGG 1 cut(s) 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.