RchiOBHm_Chr1g0316631

Belongs to the universal ribosomal protein uS8 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
4144635 .. 4144979
345 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 186 bp
ATGTATGAAGAAAAGAATCGCTTGGTTATCAATCCTTGTGTCAAGGAGATTGAAGGCTGGAATGCTAGACTTCTTCCGTCAAGACAGTTTGAATACATTGTGTTGACAACATCTGCTGGAATCATGGATCATGAGAAAGCTAGGAGAAAGAATGTTGGTGGCAAAGTTCTCGGTTTATTTTACTGA

Protein Analysis

61

Amino Acids

7.08

Weight (kDa)

9.3

Isoelectric Point (pI)

50.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S8 PF00410 30 - 61 3e-07 Ribosomal protein S8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 135
AgsI TTSAA 2 cut(s) 53, 92
AluBI AGCT 1 cut(s) 140
AluI AGCT 1 cut(s) 140
AlwI GGATC 1 cut(s) 135
BcgI CGANNNNNNTGC 2 cut(s) 151, 185
BfaI CTAG 2 cut(s) 66, 141
BsmI GAATGC 1 cut(s) 67
Bsp143I GATC 1 cut(s) 127
BspHI TCATGA 1 cut(s) 130
BspPI GGATC 1 cut(s) 135
BssMI GATC 1 cut(s) 127
Bst4CI ACNGT 1 cut(s) 87
BstKTI GATC 1 cut(s) 130
BstMBI GATC 1 cut(s) 127
CciI TCATGA 1 cut(s) 130
CviAII CATG 2 cut(s) 124, 131
CviJI RGCY 2 cut(s) 57, 140
CviKI_1 RGCY 2 cut(s) 57, 140
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
FaeI CATG 2 cut(s) 127, 134
FaiI YATR 3 cut(s) 6, 125, 132
FalI AAGNNNNNCTT 1 cut(s) 37
FatI CATG 2 cut(s) 123, 130
FspBI CTAG 2 cut(s) 66, 141
Hin1II CATG 2 cut(s) 127, 134
HincII GTYRAC 1 cut(s) 105
HindII GTYRAC 1 cut(s) 105
HinfI GANTC 2 cut(s) 16, 120
Hpy166II GTNNAC 1 cut(s) 105
Hpy188III TCNNGA 2 cut(s) 81, 131
Hpy8I GTNNAC 1 cut(s) 105
HpyAV CCTTC 1 cut(s) 47
HpyCH4III ACNGT 1 cut(s) 87
Hsp92II CATG 2 cut(s) 127, 134
Kzo9I GATC 1 cut(s) 127
LpnPI CCDG 2 cut(s) 43, 102
MaeI CTAG 2 cut(s) 66, 141
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MboII GAAGA 2 cut(s) 20, 65
Mva1269I GAATGC 1 cut(s) 67
NdeII GATC 1 cut(s) 127
NlaIII CATG 2 cut(s) 127, 134
PagI TCATGA 1 cut(s) 130
PctI GAATGC 1 cut(s) 67
PfeI GAWTC 2 cut(s) 16, 120
Sau3AI GATC 1 cut(s) 127
SetI ASST 1 cut(s) 142
SspMI CTAG 2 cut(s) 66, 141
TaaI ACNGT 1 cut(s) 87
TfiI GAWTC 2 cut(s) 16, 120
TspDTI ATGAA 1 cut(s) 21
TspGWI ACGGA 1 cut(s) 66
XspI CTAG 2 cut(s) 66, 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.