RchiOBHm_Chr1g0318381

Structural maintenance of chromosomes protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
5893615 .. 5896266
2652 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 150 bp
ATGGTTCTGTGTGTTGCATTTGGGTCTCCAGCTGAAAAGACTCAAAGAGGGTCTACACTGAAGGATTTTACAAAAAGGGGTTGCAGGTGCAACTGGAAAATGCCAAAAAAAGTATGCGAAACCTGCAGATATAAAAGTAAAATATTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.66

Weight (kDa)

9.83

Isoelectric Point (pI)

28.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029531)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0318381 RchiOBHm_Chr4g0413161

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 75
Acc36I ACCTGC 2 cut(s) 75, 131
AccI GTMKAC 1 cut(s) 53
AcuI CTGAAG 1 cut(s) 80
AluBI AGCT 1 cut(s) 32
AluI AGCT 1 cut(s) 32
Alw26I GTCTC 1 cut(s) 30
BcoDI GTCTC 1 cut(s) 30
BfmI CTRYAG 1 cut(s) 124
BfuAI ACCTGC 2 cut(s) 75, 131
BpmI CTGGAG 1 cut(s) 12
BsaI GGTCTC 1 cut(s) 30
Bse1I ACTGG 1 cut(s) 98
BseNI ACTGG 1 cut(s) 98
BsmAI GTCTC 1 cut(s) 30
Bso31I GGTCTC 1 cut(s) 30
BspMAI CTGCAG 1 cut(s) 128
BspMI ACCTGC 2 cut(s) 75, 131
BspTNI GGTCTC 1 cut(s) 30
BsrI ACTGG 1 cut(s) 98
BstMAI GTCTC 1 cut(s) 30
BstMWI GCNNNNNNNGC 1 cut(s) 123
BstSFI CTRYAG 1 cut(s) 124
BtsIMutI CAGTG 1 cut(s) 56
BveI ACCTGC 2 cut(s) 75, 131
CviJI RGCY 1 cut(s) 32
CviKI_1 RGCY 1 cut(s) 32
Eco31I GGTCTC 1 cut(s) 30
Eco57I CTGAAG 1 cut(s) 80
FaiI YATR 2 cut(s) 115, 132
FblI GTMKAC 1 cut(s) 53
GsuI CTGGAG 1 cut(s) 12
HinfI GANTC 1 cut(s) 40
Hpy166II GTNNAC 1 cut(s) 54
Hpy8I GTNNAC 1 cut(s) 54
HpyAV CCTTC 1 cut(s) 55
HpyCH4V TGCA 4 cut(s) 17, 84, 90, 126
HpyF10VI GCNNNNNNNGC 1 cut(s) 123
LpnPI CCDG 4 cut(s) 42, 70, 79, 136
MlyI GAGTC 1 cut(s) 34
MnlI CCTC 1 cut(s) 41
MspA1I CMGCKG 1 cut(s) 32
MwoI GCNNNNNNNGC 1 cut(s) 123
PaqCI CACCTGC 1 cut(s) 75
PleI GAGTC 1 cut(s) 34
PpsI GAGTC 1 cut(s) 34
PstI CTGCAG 1 cut(s) 128
PvuII CAGCTG 1 cut(s) 32
SchI GAGTC 1 cut(s) 34
SetI ASST 3 cut(s) 34, 89, 125
SfcI CTRYAG 1 cut(s) 124
SgeI CNNG 4 cut(s) 41, 97, 106, 135
SspI AATATT 1 cut(s) 144
TscAI CASTG 1 cut(s) 63
TspRI CASTG 1 cut(s) 63
XmiI GTMKAC 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.