RchiOBHm_Chr1g0319281

PAN-like domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
6904414 .. 6905547
1134 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 207 bp
ATGGGCAATCCTCCAAAGACTTCTGTCTATGATGAAAGCATTGGTATGGATATATCTCCAAGGAAAGTTGTATGGGTGGCCAATAGAGAAAAGCCTCTTGCAGGTGCAGACACCTTGGCTAGATTGAGAATTAGTAGCAATGGGAATCTGGAGCTTGTAGATGGGAAGCAGAATTCTGTGTGGTCAATCAATGTGAATACTTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.5

Weight (kDa)

8.14

Isoelectric Point (pI)

12.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
B_lectin PF01453 23 - 64 1.1e-09 D-mannose binding lectin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 92
Acc36I ACCTGC 1 cut(s) 92
AcoI YGGCCR 1 cut(s) 78
AcsI RAATTY 1 cut(s) 172
AfiI CCNNNNNNNGG 1 cut(s) 101
AluBI AGCT 1 cut(s) 154
AluI AGCT 1 cut(s) 154
AoxI GGCC 1 cut(s) 78
ApoI RAATTY 1 cut(s) 172
BalI TGGCCA 1 cut(s) 80
BccI CCATC 1 cut(s) 155
BfaI CTAG 1 cut(s) 120
BfuAI ACCTGC 1 cut(s) 92
BoxI GACNNNNGTC 1 cut(s) 23
BpmI CTGGAG 1 cut(s) 170
BsaJI CCNNGG 2 cut(s) 59, 114
Bsc4I CCNNNNNNNGG 1 cut(s) 101
Bse3DI GCAATG 1 cut(s) 145
BseDI CCNNGG 2 cut(s) 59, 114
BseLI CCNNNNNNNGG 1 cut(s) 101
BseMI GCAATG 1 cut(s) 145
BsgI GTGCAG 1 cut(s) 126
BshFI GGCC 1 cut(s) 80
BslI CCNNNNNNNGG 1 cut(s) 101
BsnI GGCC 1 cut(s) 80
BspANI GGCC 1 cut(s) 80
BspMI ACCTGC 1 cut(s) 92
BsrDI GCAATG 1 cut(s) 145
BssECI CCNNGG 2 cut(s) 59, 114
BssT1I CCWWGG 2 cut(s) 59, 114
BstENI CCTNNNNNAGG 1 cut(s) 99
BstPAI GACNNNNGTC 1 cut(s) 23
BsuRI GGCC 1 cut(s) 80
BveI ACCTGC 1 cut(s) 92
CviJI RGCY 4 cut(s) 80, 94, 119, 154
CviKI_1 RGCY 4 cut(s) 80, 94, 119, 154
EaeI YGGCCR 1 cut(s) 78
Eco130I CCWWGG 2 cut(s) 59, 114
EcoNI CCTNNNNNAGG 1 cut(s) 99
EcoRI GAATTC 1 cut(s) 172
EcoT14I CCWWGG 2 cut(s) 59, 114
ErhI CCWWGG 2 cut(s) 59, 114
FaiI YATR 4 cut(s) 30, 47, 53, 73
FspBI CTAG 1 cut(s) 120
GsuI CTGGAG 1 cut(s) 170
HaeIII GGCC 1 cut(s) 80
HinfI GANTC 1 cut(s) 145
Hpy188III TCNNGA 1 cut(s) 149
HpyCH4V TGCA 2 cut(s) 101, 107
LmnI GCTCC 1 cut(s) 151
LpnPI CCDG 2 cut(s) 87, 134
MaeI CTAG 1 cut(s) 120
MlsI TGGCCA 1 cut(s) 80
MluCI AATT 2 cut(s) 129, 172
MluNI TGGCCA 1 cut(s) 80
MnlI CCTC 2 cut(s) 21, 105
Mox20I TGGCCA 1 cut(s) 80
MscI TGGCCA 1 cut(s) 80
MslI CAYNNNNRTG 1 cut(s) 44
Msp20I TGGCCA 1 cut(s) 80
PaqCI CACCTGC 1 cut(s) 92
PfeI GAWTC 1 cut(s) 145
PshAI GACNNNNGTC 1 cut(s) 23
RseI CAYNNNNRTG 1 cut(s) 44
SetI ASST 3 cut(s) 106, 116, 156
SgeI CNNG 7 cut(s) 72, 110, 114, 127, 132, 161, 167
SmiMI CAYNNNNRTG 1 cut(s) 44
Sse9I AATT 2 cut(s) 129, 172
SspMI CTAG 1 cut(s) 120
StyI CCWWGG 2 cut(s) 59, 114
TasI AATT 2 cut(s) 129, 172
TfiI GAWTC 1 cut(s) 145
TspDTI ATGAA 1 cut(s) 48
XagI CCTNNNNNAGG 1 cut(s) 99
XapI RAATTY 1 cut(s) 172
XspI CTAG 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.