RchiOBHm_Chr1g0319301

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
6907830 .. 6908902
1073 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 330 bp
ATGGCTGATAAGATTCAGACTTCACGAGCCACAATAAGAGAATATATTGGAAAAGATGATCCATCTGAGCTATTGATCTATGATTTTGATAACATATTAGTTGCTACAAACAATTTCAGTCTCGCAAACAAACTCAGGCAAGGAGGATTTGGCCCAGTTTATAAGGGTAAGCTACCAGAAGGGAAGGAAATAGCAGTAAAAAGACTATCTAGTAGCTCAGGCCAAGGCAAAGAAGAGTTCAACAATGAGACTTTGTTGATCTCCAATCTTCAACATAAAAATCTTGTTAGACTCATGGGTGCTGTGTTAAAGGGGATGAGAAGTTACTGA

Protein Analysis

109

Amino Acids

12.15

Weight (kDa)

9.43

Isoelectric Point (pI)

44.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 41 - 105 9.5e-10 Protein tyrosine and serine/threonine kinase
Pkinase PF00069 42 - 104 5.3e-07 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 162
AclWI GGATC 1 cut(s) 53
AgsI TTSAA 2 cut(s) 241, 272
AluBI AGCT 3 cut(s) 70, 172, 216
AluI AGCT 3 cut(s) 70, 172, 216
Alw26I GTCTC 2 cut(s) 125, 242
AlwI GGATC 1 cut(s) 53
AoxI GGCC 2 cut(s) 151, 220
AspS9I GGNCC 1 cut(s) 152
BauI CACGAG 1 cut(s) 24
BccI CCATC 1 cut(s) 70
BcoDI GTCTC 2 cut(s) 125, 242
BfaI CTAG 1 cut(s) 210
BmgT120I GGNCC 1 cut(s) 152
BmrI ACTGGG 1 cut(s) 149
BmuI ACTGGG 1 cut(s) 149
Bpu10I CCTNAGC 1 cut(s) 217
BsaJI CCNNGG 1 cut(s) 223
Bse1I ACTGG 1 cut(s) 155
BseDI CCNNGG 1 cut(s) 223
BseGI GGATG 1 cut(s) 321
BseMII CTCAG 3 cut(s) 57, 148, 231
BseNI ACTGG 1 cut(s) 155
BshFI GGCC 2 cut(s) 153, 222
BsmAI GTCTC 2 cut(s) 125, 242
BsnI GGCC 2 cut(s) 153, 222
Bsp143I GATC 3 cut(s) 58, 75, 258
BspANI GGCC 2 cut(s) 153, 222
BspCNI CTCAG 3 cut(s) 58, 147, 230
BspPI GGATC 1 cut(s) 53
BsrI ACTGG 1 cut(s) 155
BssECI CCNNGG 1 cut(s) 223
BssMI GATC 3 cut(s) 58, 75, 258
BssSI CACGAG 1 cut(s) 24
BssT1I CCWWGG 1 cut(s) 223
Bst2BI CACGAG 1 cut(s) 24
Bst6I CTCTTC 1 cut(s) 228
BstDEI CTNAG 3 cut(s) 66, 134, 217
BstF5I GGATG 1 cut(s) 321
BstKTI GATC 3 cut(s) 61, 78, 261
BstMAI GTCTC 2 cut(s) 125, 242
BstMBI GATC 3 cut(s) 58, 75, 258
BsuRI GGCC 2 cut(s) 153, 222
BtsCI GGATG 1 cut(s) 321
Cfr13I GGNCC 1 cut(s) 152
CviAII CATG 1 cut(s) 295
CviJI RGCY 7 cut(s) 5, 29, 70, 153, 172, 216, 222
CviKI_1 RGCY 7 cut(s) 5, 29, 70, 153, 172, 216, 222
DdeI CTNAG 3 cut(s) 66, 134, 217
DpnI GATC 3 cut(s) 60, 77, 260
DpnII GATC 3 cut(s) 58, 75, 258
Eam1104I CTCTTC 1 cut(s) 228
EarI CTCTTC 1 cut(s) 228
Eco130I CCWWGG 1 cut(s) 223
EcoT14I CCWWGG 1 cut(s) 223
ErhI CCWWGG 1 cut(s) 223
FaeI CATG 1 cut(s) 298
FaiI YATR 6 cut(s) 45, 81, 95, 162, 276, 296
FatI CATG 1 cut(s) 294
FspBI CTAG 1 cut(s) 210
HaeIII GGCC 2 cut(s) 153, 222
Hin1II CATG 1 cut(s) 298
HinfI GANTC 2 cut(s) 13, 291
Hpy188I TCNGA 2 cut(s) 18, 67
Hpy188III TCNNGA 1 cut(s) 24
HpyAV CCTTC 2 cut(s) 173, 178
HpyF3I CTNAG 3 cut(s) 66, 134, 217
Hsp92II CATG 1 cut(s) 298
Kzo9I GATC 3 cut(s) 58, 75, 258
LpnPI CCDG 4 cut(s) 121, 168, 189, 204
MaeI CTAG 1 cut(s) 210
MaeIII GTNAC 1 cut(s) 323
MalI GATC 3 cut(s) 60, 77, 260
MboI GATC 3 cut(s) 58, 75, 258
MboII GAAGA 2 cut(s) 245, 260
MluCI AATT 1 cut(s) 112
MlyI GAGTC 1 cut(s) 285
MnlI CCTC 1 cut(s) 137
MseI TTAA 1 cut(s) 308
NdeII GATC 3 cut(s) 58, 75, 258
NlaIII CATG 1 cut(s) 298
PfeI GAWTC 1 cut(s) 13
PleI GAGTC 1 cut(s) 285
PpsI GAGTC 1 cut(s) 285
PsiI TTATAA 1 cut(s) 162
PspPI GGNCC 1 cut(s) 152
SaqAI TTAA 1 cut(s) 308
Sau3AI GATC 3 cut(s) 58, 75, 258
Sau96I GGNCC 1 cut(s) 152
SchI GAGTC 1 cut(s) 285
SetI ASST 3 cut(s) 72, 174, 218
Sse9I AATT 1 cut(s) 112
SspMI CTAG 1 cut(s) 210
StyI CCWWGG 1 cut(s) 223
TasI AATT 1 cut(s) 112
TfiI GAWTC 1 cut(s) 13
Tru1I TTAA 1 cut(s) 308
Tru9I TTAA 1 cut(s) 308
XspI CTAG 1 cut(s) 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.