RchiOBHm_Chr1g0320511

U3 small nucleolar ribonucleoprotein protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
8135089 .. 8135534
446 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 207 bp
ATGAAAATGATTACACTGCCAAAAAGTTACCTCAGCATTACCAAATTTTGGAATGGAGTTGAAACTGCTTGCCAGTTTCTTCTATTGATGAAAATCAGTTTCTTTATAAAGTTAGGAACAGTGGATCAGAATGAAGCCCAGAATGAATGGGTCCTCAAACAGTACATGAACACAGCCAGCAAGAAACAGAATTTTATAGGGAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.92

Weight (kDa)

9.47

Isoelectric Point (pI)

17.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029603)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0320511 RchiOBHm_Chr1g0320631

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 107
AccB7I CCANNNNNTGG 1 cut(s) 48
AclWI GGATC 1 cut(s) 132
AcsI RAATTY 2 cut(s) 44, 190
AfaI GTAC 1 cut(s) 164
AfiI CCNNNNNNNGG 1 cut(s) 48
AgsI TTSAA 1 cut(s) 62
AlwI GGATC 1 cut(s) 132
ApoI RAATTY 2 cut(s) 44, 190
AspS9I GGNCC 1 cut(s) 151
AvaII GGWCC 1 cut(s) 151
BbvCI CCTCAGC 1 cut(s) 32
Bme18I GGWCC 1 cut(s) 151
BmgT120I GGNCC 1 cut(s) 151
BmiI GGNNCC 1 cut(s) 152
Bpu10I CCTNAGC 1 cut(s) 32
BsaBI GATNNNNATC 1 cut(s) 92
Bsc4I CCNNNNNNNGG 1 cut(s) 48
Bse1I ACTGG 1 cut(s) 73
Bse8I GATNNNNATC 1 cut(s) 92
BseJI GATNNNNATC 1 cut(s) 92
BseLI CCNNNNNNNGG 1 cut(s) 48
BseMII CTCAG 1 cut(s) 46
BseNI ACTGG 1 cut(s) 73
BslI CCNNNNNNNGG 1 cut(s) 48
Bsp143I GATC 1 cut(s) 124
BspCNI CTCAG 1 cut(s) 45
BspLI GGNNCC 1 cut(s) 152
BspPI GGATC 1 cut(s) 132
BsrI ACTGG 1 cut(s) 73
BssMI GATC 1 cut(s) 124
Bst4CI ACNGT 2 cut(s) 121, 162
BstC8I GCNNGC 2 cut(s) 70, 178
BstDEI CTNAG 1 cut(s) 32
BstKTI GATC 1 cut(s) 127
BstMBI GATC 1 cut(s) 124
BtsI GCAGTG 1 cut(s) 14
BtsIMutI CAGTG 2 cut(s) 14, 126
Cac8I GCNNGC 2 cut(s) 70, 178
Cfr13I GGNCC 1 cut(s) 151
Csp6I GTAC 1 cut(s) 163
CviAII CATG 1 cut(s) 166
CviJI RGCY 2 cut(s) 137, 176
CviKI_1 RGCY 2 cut(s) 137, 176
CviQI GTAC 1 cut(s) 163
DdeI CTNAG 1 cut(s) 32
DpnI GATC 1 cut(s) 126
DpnII GATC 1 cut(s) 124
Eco47I GGWCC 1 cut(s) 151
EcoO109I RGGNCCY 1 cut(s) 151
FaeI CATG 1 cut(s) 169
FaiI YATR 3 cut(s) 107, 167, 197
FatI CATG 1 cut(s) 165
Hin1II CATG 1 cut(s) 169
Hpy188I TCNGA 1 cut(s) 129
HpyCH4III ACNGT 2 cut(s) 121, 162
HpyF3I CTNAG 1 cut(s) 32
Hsp92II CATG 1 cut(s) 169
Kzo9I GATC 1 cut(s) 124
LpnPI CCDG 3 cut(s) 86, 152, 190
MaeIII GTNAC 1 cut(s) 26
MalI GATC 1 cut(s) 126
MboI GATC 1 cut(s) 124
MboII GAAGA 1 cut(s) 71
MluCI AATT 3 cut(s) 44, 190, 202
MnlI CCTC 2 cut(s) 41, 164
NdeII GATC 1 cut(s) 124
NlaIII CATG 1 cut(s) 169
NlaIV GGNNCC 1 cut(s) 152
PflMI CCANNNNNTGG 1 cut(s) 48
PpuMI RGGWCCY 1 cut(s) 151
PsiI TTATAA 1 cut(s) 107
Psp5II RGGWCCY 1 cut(s) 151
PspN4I GGNNCC 1 cut(s) 152
PspPI GGNCC 1 cut(s) 151
PspPPI RGGWCCY 1 cut(s) 151
RsaI GTAC 1 cut(s) 164
RsaNI GTAC 1 cut(s) 163
Sau3AI GATC 1 cut(s) 124
Sau96I GGNCC 1 cut(s) 151
SetI ASST 1 cut(s) 33
SgeI CNNG 6 cut(s) 81, 85, 151, 178, 189, 193
SinI GGWCC 1 cut(s) 151
Sse9I AATT 3 cut(s) 44, 190, 202
TaaI ACNGT 2 cut(s) 121, 162
TasI AATT 3 cut(s) 44, 190, 202
TatI WGTACW 1 cut(s) 162
TscAI CASTG 2 cut(s) 21, 126
TspDTI ATGAA 5 cut(s) 17, 104, 147, 159, 182
TspRI CASTG 2 cut(s) 21, 126
Van91I CCANNNNNTGG 1 cut(s) 48
VpaK11BI GGWCC 1 cut(s) 151
XapI RAATTY 2 cut(s) 44, 190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.