RchiOBHm_Chr1g0320521

U3 small nucleolar ribonucleoprotein protein IMP4-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
8143263 .. 8144049
787 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 144 bp
ATGGGAACGGTGCCACAGGCTTATCCACATTTGATTATTAACAATTTCACGACTAAGTTGGGTGAGCGGACAGCAAATATTTTAAAGCATCTTTTTCCAGTGCCAAAGCCAGATACCAAACGCATAATTACTTTTTTCGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

47

Amino Acids

5.41

Weight (kDa)

9.82

Isoelectric Point (pI)

39.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 10
AccBSI CCGCTC 1 cut(s) 67
AciI CCGC 1 cut(s) 67
AsuHPI GGTGA 1 cut(s) 74
AsuII TTCGAA 1 cut(s) 138
BanI GGYRCC 1 cut(s) 10
BmiI GGNNCC 1 cut(s) 12
BmsI GCATC 1 cut(s) 97
Bpu14I TTCGAA 1 cut(s) 138
Bse1I ACTGG 1 cut(s) 98
BseNI ACTGG 1 cut(s) 98
BshNI GGYRCC 1 cut(s) 10
Bsp119I TTCGAA 1 cut(s) 138
BspACI CCGC 1 cut(s) 67
BspLI GGNNCC 1 cut(s) 12
BspT104I TTCGAA 1 cut(s) 138
BspT107I GGYRCC 1 cut(s) 10
BsrBI CCGCTC 1 cut(s) 67
BsrI ACTGG 1 cut(s) 98
Bst4CI ACNGT 1 cut(s) 10
BstBI TTCGAA 1 cut(s) 138
BstDEI CTNAG 1 cut(s) 54
BtsIMutI CAGTG 1 cut(s) 105
CviJI RGCY 2 cut(s) 20, 109
CviKI_1 RGCY 2 cut(s) 20, 109
DdeI CTNAG 1 cut(s) 54
DraI TTTAAA 1 cut(s) 84
FaiI YATR 1 cut(s) 125
HphI GGTGA 1 cut(s) 74
Hpy188III TCNNGA 1 cut(s) 49
HpyCH4III ACNGT 1 cut(s) 10
HpyF3I CTNAG 1 cut(s) 54
LpnPI CCDG 3 cut(s) 2, 111, 123
LweI GCATC 1 cut(s) 97
MbiI CCGCTC 1 cut(s) 67
MluCI AATT 2 cut(s) 43, 126
MseI TTAA 2 cut(s) 39, 83
NlaIV GGNNCC 1 cut(s) 12
NspV TTCGAA 1 cut(s) 138
PspN4I GGNNCC 1 cut(s) 12
SaqAI TTAA 2 cut(s) 39, 83
SfaNI GCATC 1 cut(s) 97
SfuI TTCGAA 1 cut(s) 138
SgeI CNNG 4 cut(s) 29, 61, 110, 122
Sse9I AATT 2 cut(s) 43, 126
SsiI CCGC 1 cut(s) 67
SspI AATATT 1 cut(s) 79
TaaI ACNGT 1 cut(s) 10
TaqI TCGA 1 cut(s) 138
TasI AATT 2 cut(s) 43, 126
Tru1I TTAA 2 cut(s) 39, 83
Tru9I TTAA 2 cut(s) 39, 83
TscAI CASTG 1 cut(s) 105
TspRI CASTG 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.