RchiOBHm_Chr1g0321561

Annexin-like protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
9083256 .. 9084219
964 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 165 bp
ATGGCATCCCTCATTACTCCTGATCAATTTTCTGCTAACCAAGATGCAGAGGCTCTCCGAAAGGCGTGTCAAGGCTCAATGAGAATAAAATTCCAATTTAAGCTCCATAATGGCCGAGCGACCTTTGCTATAAATTTGGGCATTGAAAGAGCCAGAATACACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

6.07

Weight (kDa)

10.27

Isoelectric Point (pI)

25.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 112
AcsI RAATTY 2 cut(s) 89, 133
AgsI TTSAA 1 cut(s) 146
AluBI AGCT 1 cut(s) 103
AluI AGCT 1 cut(s) 103
AoxI GGCC 1 cut(s) 112
ApoI RAATTY 2 cut(s) 89, 133
ArsI GACNNNNNNTTYG 2 cut(s) 52, 84
BclI TGATCA 1 cut(s) 22
BfaI CTAG 1 cut(s) 163
BmsI GCATC 2 cut(s) 14, 34
BseGI GGATG 1 cut(s) 5
BshFI GGCC 1 cut(s) 114
BsnI GGCC 1 cut(s) 114
Bsp143I GATC 1 cut(s) 22
BspANI GGCC 1 cut(s) 114
BssMI GATC 1 cut(s) 22
BstF5I GGATG 1 cut(s) 5
BstKTI GATC 1 cut(s) 25
BstMBI GATC 1 cut(s) 22
BstMWI GCNNNNNNNGC 1 cut(s) 125
BsuRI GGCC 1 cut(s) 114
BtsCI GGATG 1 cut(s) 5
CviJI RGCY 5 cut(s) 53, 75, 103, 114, 152
CviKI_1 RGCY 5 cut(s) 53, 75, 103, 114, 152
DpnI GATC 1 cut(s) 24
DpnII GATC 1 cut(s) 22
EaeI YGGCCR 1 cut(s) 112
FaiI YATR 2 cut(s) 108, 131
FbaI TGATCA 1 cut(s) 22
FspBI CTAG 1 cut(s) 163
HaeIII GGCC 1 cut(s) 114
Hpy188I TCNGA 1 cut(s) 59
Hpy188III TCNNGA 1 cut(s) 20
HpyCH4V TGCA 1 cut(s) 47
HpyF10VI GCNNNNNNNGC 1 cut(s) 125
Ksp22I TGATCA 1 cut(s) 22
Kzo9I GATC 1 cut(s) 22
LmnI GCTCC 1 cut(s) 108
LpnPI CCDG 1 cut(s) 33
LweI GCATC 2 cut(s) 14, 34
MaeI CTAG 1 cut(s) 163
MalI GATC 1 cut(s) 24
MboI GATC 1 cut(s) 22
MluCI AATT 4 cut(s) 26, 89, 95, 133
MnlI CCTC 2 cut(s) 20, 43
MseI TTAA 1 cut(s) 99
MwoI GCNNNNNNNGC 1 cut(s) 125
NdeII GATC 1 cut(s) 22
NmeAIII GCCGAG 1 cut(s) 140
SaqAI TTAA 1 cut(s) 99
Sau3AI GATC 1 cut(s) 22
SetI ASST 2 cut(s) 105, 125
SfaNI GCATC 2 cut(s) 14, 34
SgeI CNNG 5 cut(s) 32, 53, 78, 83, 128
Sse9I AATT 4 cut(s) 26, 89, 95, 133
SspMI CTAG 1 cut(s) 163
TasI AATT 4 cut(s) 26, 89, 95, 133
Tru1I TTAA 1 cut(s) 99
Tru9I TTAA 1 cut(s) 99
XapI RAATTY 2 cut(s) 89, 133
XspI CTAG 1 cut(s) 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.