RchiOBHm_Chr1g0322541

urease accessory protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
9887443 .. 9888879
1437 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 171 bp
ATGTTTATCACAATGAGAGATGTTATGTCTGCTGCAACAAGGCTGAATTTGGTCGGACCCCTTGGTGCGGCTGTTCTGCAACATCATATAGCTCCTATCTCTGAAGCTATACTGAATCAATGCAAGGACCTTCTAGTTGAGGAAGCATGCCTTAACTGTTCCTTTGCTTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.04

Weight (kDa)

5.38

Isoelectric Point (pI)

51.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 68
AcsI RAATTY 1 cut(s) 46
AcuI CTGAAG 1 cut(s) 123
AfiI CCNNNNNNNGG 1 cut(s) 67
AluBI AGCT 2 cut(s) 92, 107
AluI AGCT 2 cut(s) 92, 107
ApeKI GCWGC 1 cut(s) 32
ApoI RAATTY 1 cut(s) 46
AspS9I GGNCC 2 cut(s) 56, 127
AvaII GGWCC 2 cut(s) 56, 127
BbvI GCAGC 1 cut(s) 19
BfaI CTAG 1 cut(s) 134
BisI GCNGC 2 cut(s) 33, 69
BlsI GCNGC 2 cut(s) 34, 70
Bme18I GGWCC 2 cut(s) 56, 127
BmgT120I GGNCC 2 cut(s) 56, 127
BmiI GGNNCC 1 cut(s) 58
BsaJI CCNNGG 1 cut(s) 61
Bsc4I CCNNNNNNNGG 1 cut(s) 67
BseDI CCNNGG 1 cut(s) 61
BseLI CCNNNNNNNGG 1 cut(s) 67
BseXI GCAGC 1 cut(s) 19
BslI CCNNNNNNNGG 1 cut(s) 67
BspACI CCGC 1 cut(s) 68
BspLI GGNNCC 1 cut(s) 58
BssECI CCNNGG 1 cut(s) 61
BssT1I CCWWGG 1 cut(s) 61
Bst4CI ACNGT 1 cut(s) 158
BstC8I GCNNGC 1 cut(s) 148
BstNSI RCATGY 1 cut(s) 150
BstV1I GCAGC 1 cut(s) 19
Cac8I GCNNGC 1 cut(s) 148
Cfr13I GGNCC 2 cut(s) 56, 127
CviAII CATG 1 cut(s) 147
CviJI RGCY 4 cut(s) 43, 71, 92, 107
CviKI_1 RGCY 4 cut(s) 43, 71, 92, 107
Eco130I CCWWGG 1 cut(s) 61
Eco47I GGWCC 2 cut(s) 56, 127
Eco57I CTGAAG 1 cut(s) 123
EcoO109I RGGNCCY 1 cut(s) 127
EcoT14I CCWWGG 1 cut(s) 61
ErhI CCWWGG 1 cut(s) 61
FaeI CATG 1 cut(s) 150
FaiI YATR 5 cut(s) 26, 87, 89, 110, 148
FalI AAGNNNNNCTT 2 cut(s) 135, 167
FatI CATG 1 cut(s) 146
Fnu4HI GCNGC 2 cut(s) 33, 69
Fsp4HI GCNGC 2 cut(s) 33, 69
FspBI CTAG 1 cut(s) 134
GluI GCNGC 2 cut(s) 33, 69
Hin1II CATG 1 cut(s) 150
HinfI GANTC 1 cut(s) 115
Hpy188I TCNGA 2 cut(s) 56, 103
HpyAV CCTTC 1 cut(s) 140
HpyCH4III ACNGT 1 cut(s) 158
HpyCH4V TGCA 3 cut(s) 35, 79, 123
Hsp92II CATG 1 cut(s) 150
LmnI GCTCC 1 cut(s) 97
Lsp1109I GCAGC 1 cut(s) 19
MaeI CTAG 1 cut(s) 134
MluCI AATT 1 cut(s) 46
MmeI TCCRAC 1 cut(s) 34
MnlI CCTC 1 cut(s) 133
MseI TTAA 1 cut(s) 153
NlaIII CATG 1 cut(s) 150
NlaIV GGNNCC 1 cut(s) 58
NspI RCATGY 1 cut(s) 150
PaeI GCATGC 1 cut(s) 150
PfeI GAWTC 1 cut(s) 115
PkrI GCNGC 2 cut(s) 34, 70
PpuMI RGGWCCY 1 cut(s) 127
Psp5II RGGWCCY 1 cut(s) 127
PspN4I GGNNCC 1 cut(s) 58
PspPI GGNCC 2 cut(s) 56, 127
PspPPI RGGWCCY 1 cut(s) 127
SaqAI TTAA 1 cut(s) 153
SatI GCNGC 2 cut(s) 33, 69
Sau96I GGNCC 2 cut(s) 56, 127
SetI ASST 3 cut(s) 94, 109, 132
SgeI CNNG 5 cut(s) 51, 74, 136, 146, 159
SinI GGWCC 2 cut(s) 56, 127
SphI GCATGC 1 cut(s) 150
Sse9I AATT 1 cut(s) 46
SsiI CCGC 1 cut(s) 68
SspMI CTAG 1 cut(s) 134
StyI CCWWGG 1 cut(s) 61
TaaI ACNGT 1 cut(s) 158
TasI AATT 1 cut(s) 46
TauI GCSGC 1 cut(s) 71
TfiI GAWTC 1 cut(s) 115
Tru1I TTAA 1 cut(s) 153
Tru9I TTAA 1 cut(s) 153
TseI GCWGC 1 cut(s) 32
VpaK11BI GGWCC 2 cut(s) 56, 127
XapI RAATTY 1 cut(s) 46
XceI RCATGY 1 cut(s) 150
XspI CTAG 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.