RchiOBHm_Chr1g0322561

resistance protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
9905111 .. 9909469
4359 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 171 bp
ATGCATGATTTGCTACAAGAATTGGGCTGGGAAATTGTTCGTGAACAGTCTCCCAAAGAGCCAGGCAAACGTAGTAGATTATGGTCTCATGAAGACATCAACAATGTGCTGAAGAAAAATAAGGCAAAAGGGAACAGATTCAATTCAAGGCATGGTAATGGAGTTGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.55

Weight (kDa)

9.69

Isoelectric Point (pI)

77.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 131
AgsI TTSAA 2 cut(s) 142, 147
AjnI CCWGG 1 cut(s) 61
Alw26I GTCTC 2 cut(s) 54, 90
Asp700I GAANNNNTTC 2 cut(s) 36, 137
BbsI GAAGAC 1 cut(s) 99
BciT130I CCWGG 1 cut(s) 63
BcoDI GTCTC 2 cut(s) 54, 90
Bme1390I CCNGG 1 cut(s) 63
BmrFI CCNGG 1 cut(s) 63
BpiI GAAGAC 1 cut(s) 99
BsaI GGTCTC 1 cut(s) 90
BseBI CCWGG 1 cut(s) 63
BseYI CCCAGC 1 cut(s) 27
BsmAI GTCTC 2 cut(s) 54, 90
Bso31I GGTCTC 1 cut(s) 90
BspHI TCATGA 1 cut(s) 88
BspTNI GGTCTC 1 cut(s) 90
Bst2UI CCWGG 1 cut(s) 63
Bst4CI ACNGT 1 cut(s) 48
BstAPI GCANNNNNTGC 1 cut(s) 10
BstMAI GTCTC 2 cut(s) 54, 90
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstNI CCWGG 1 cut(s) 63
BstSCI CCNGG 1 cut(s) 61
BstV2I GAAGAC 1 cut(s) 99
CciI TCATGA 1 cut(s) 88
CviAII CATG 3 cut(s) 5, 89, 152
CviJI RGCY 2 cut(s) 27, 61
CviKI_1 RGCY 2 cut(s) 27, 61
Eco31I GGTCTC 1 cut(s) 90
Eco57I CTGAAG 1 cut(s) 131
EcoRII CCWGG 1 cut(s) 61
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 3 cut(s) 8, 92, 155
FaiI YATR 4 cut(s) 6, 82, 90, 153
FatI CATG 3 cut(s) 4, 88, 151
GsaI CCCAGC 1 cut(s) 31
Hin1II CATG 3 cut(s) 8, 92, 155
HincII GTYRAC 1 cut(s) 166
HindII GTYRAC 1 cut(s) 166
HinfI GANTC 1 cut(s) 138
Hpy166II GTNNAC 2 cut(s) 44, 166
Hpy188III TCNNGA 2 cut(s) 41, 89
Hpy8I GTNNAC 2 cut(s) 44, 166
HpyCH4III ACNGT 1 cut(s) 48
HpyCH4IV ACGT 1 cut(s) 70
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
HpySE526I ACGT 1 cut(s) 70
Hsp92II CATG 3 cut(s) 8, 92, 155
LpnPI CCDG 3 cut(s) 13, 48, 75
MaeII ACGT 1 cut(s) 70
MboII GAAGA 2 cut(s) 104, 124
MluCI AATT 3 cut(s) 20, 33, 142
Mph1103I ATGCAT 1 cut(s) 6
MroXI GAANNNNTTC 2 cut(s) 36, 137
MslI CAYNNNNRTG 1 cut(s) 156
MspR9I CCNGG 1 cut(s) 63
MvaI CCWGG 1 cut(s) 63
MwoI GCNNNNNNNGC 1 cut(s) 10
NlaIII CATG 3 cut(s) 8, 92, 155
NsiI ATGCAT 1 cut(s) 6
PagI TCATGA 1 cut(s) 88
PdmI GAANNNNTTC 2 cut(s) 36, 137
PfeI GAWTC 1 cut(s) 138
Psp6I CCWGG 1 cut(s) 61
PspFI CCCAGC 1 cut(s) 27
PspGI CCWGG 1 cut(s) 61
RseI CAYNNNNRTG 1 cut(s) 156
ScrFI CCNGG 1 cut(s) 63
SetI ASST 1 cut(s) 73
SgeI CNNG 9 cut(s) 17, 29, 40, 53, 74, 75, 101, 159, 164
SmiMI CAYNNNNRTG 1 cut(s) 156
Sse9I AATT 3 cut(s) 20, 33, 142
StyD4I CCNGG 1 cut(s) 61
TaaI ACNGT 1 cut(s) 48
TaiI ACGT 1 cut(s) 73
TasI AATT 3 cut(s) 20, 33, 142
TfiI GAWTC 1 cut(s) 138
TspDTI ATGAA 1 cut(s) 105
XmnI GAANNNNTTC 2 cut(s) 36, 137
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.