RchiOBHm_Chr1g0322611

DNA (cytosine-5)-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
9943691 .. 9944564
874 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 339 bp
ATGGGTGTTTCGTTTTTGTACTGCTTGCTGAACTTAATGAAAGGGCTGACCTATTTTGATAAAAAAAAAATGGTTCATTGGGATTTAGATATTCTCTCTATTAAATTCGCTCATAGGTTCGTTTGCATTTATATTTCCTACAGTTTCACTTTACCACAGAGTTATATTTGCTTCGTGGCTTATCACCCGTCAGTTTTGAAAGATCAATTTCCCAATGGGATCAATGTCCTCTCTCTTTTCTCTGGGATTGCTGGTGCAGAGATAGCTCTTCACCGTCTTGGTATCCTGATGAAGATGTTGGAAAATATGGACTTCACATTATCTCATAGCATTAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

12.87

Weight (kDa)

8.81

Isoelectric Point (pI)

24.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 227
AcsI RAATTY 1 cut(s) 104
AfaI GTAC 1 cut(s) 20
AgsI TTSAA 1 cut(s) 199
AluBI AGCT 1 cut(s) 266
AluI AGCT 1 cut(s) 266
AlwI GGATC 1 cut(s) 227
ApoI RAATTY 1 cut(s) 104
AsuHPI GGTGA 2 cut(s) 176, 263
BciVI GTATCC 1 cut(s) 293
BfmI CTRYAG 1 cut(s) 139
BfuI GTATCC 1 cut(s) 293
BsgI GTGCAG 1 cut(s) 276
Bsp143I GATC 2 cut(s) 202, 219
BspPI GGATC 1 cut(s) 227
BspQI GCTCTTC 1 cut(s) 273
BssMI GATC 2 cut(s) 202, 219
Bst4CI ACNGT 2 cut(s) 143, 275
Bst6I CTCTTC 1 cut(s) 273
BstC8I GCNNGC 1 cut(s) 26
BstKTI GATC 2 cut(s) 205, 222
BstMBI GATC 2 cut(s) 202, 219
BstMWI GCNNNNNNNGC 1 cut(s) 263
BstSFI CTRYAG 1 cut(s) 139
BsuI GTATCC 1 cut(s) 293
Cac8I GCNNGC 1 cut(s) 26
Csp6I GTAC 1 cut(s) 19
CviJI RGCY 3 cut(s) 46, 179, 266
CviKI_1 RGCY 3 cut(s) 46, 179, 266
CviQI GTAC 1 cut(s) 19
DpnI GATC 2 cut(s) 204, 221
DpnII GATC 2 cut(s) 202, 219
Eam1104I CTCTTC 1 cut(s) 273
EarI CTCTTC 1 cut(s) 273
FaiI YATR 5 cut(s) 114, 132, 165, 308, 327
HphI GGTGA 2 cut(s) 176, 263
Hpy188III TCNNGA 1 cut(s) 286
HpyCH4III ACNGT 2 cut(s) 143, 275
HpyCH4V TGCA 2 cut(s) 126, 257
HpyF10VI GCNNNNNNNGC 1 cut(s) 263
Kzo9I GATC 2 cut(s) 202, 219
LguI GCTCTTC 1 cut(s) 273
LpnPI CCDG 3 cut(s) 228, 237, 299
MalI GATC 2 cut(s) 204, 221
MboI GATC 2 cut(s) 202, 219
MboII GAAGA 2 cut(s) 260, 304
MluCI AATT 2 cut(s) 104, 206
MmeI TCCRAC 1 cut(s) 279
MnlI CCTC 1 cut(s) 239
MseI TTAA 3 cut(s) 35, 102, 333
MwoI GCNNNNNNNGC 1 cut(s) 263
NdeII GATC 2 cut(s) 202, 219
PciSI GCTCTTC 1 cut(s) 273
RsaI GTAC 1 cut(s) 20
RsaNI GTAC 1 cut(s) 19
SapI GCTCTTC 1 cut(s) 273
SaqAI TTAA 3 cut(s) 35, 102, 333
Sau3AI GATC 2 cut(s) 202, 219
SetI ASST 3 cut(s) 53, 119, 268
SfcI CTRYAG 1 cut(s) 139
SgeI CNNG 7 cut(s) 37, 187, 199, 255, 264, 290, 298
Sse9I AATT 2 cut(s) 104, 206
TaaI ACNGT 2 cut(s) 143, 275
TasI AATT 2 cut(s) 104, 206
TatI WGTACW 1 cut(s) 18
Tru1I TTAA 3 cut(s) 35, 102, 333
Tru9I TTAA 3 cut(s) 35, 102, 333
TspDTI ATGAA 3 cut(s) 53, 65, 305
XapI RAATTY 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.