RchiOBHm_Chr1g0326881

ABC transporter I family member

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
15448822 .. 15449035
214 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 144 bp
ATGGATGTTTGGGCTGATAAATTGATCAACGGGGTAGCTGGGATTGACCCACAAAGGAGAGCTGAGCTGATCAAGGTGTTGGATATTGATCTTTCATGGAGGTGCTTCTGCTTGATGAGATCACGGTGGACCTTGATGTGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

47

Amino Acids

5.54

Weight (kDa)

7.72

Isoelectric Point (pI)

33.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 3 cut(s) 38, 62, 67
AluI AGCT 3 cut(s) 38, 62, 67
AspS9I GGNCC 1 cut(s) 129
AvaII GGWCC 1 cut(s) 129
BclI TGATCA 2 cut(s) 24, 69
BfaI CTAG 1 cut(s) 142
BlpI GCTNAGC 1 cut(s) 63
Bme18I GGWCC 1 cut(s) 129
BmgT120I GGNCC 1 cut(s) 129
Bpu1102I GCTNAGC 1 cut(s) 63
BsaBI GATNNNNATC 1 cut(s) 87
Bse8I GATNNNNATC 1 cut(s) 87
BseGI GGATG 1 cut(s) 10
BseJI GATNNNNATC 1 cut(s) 87
BseMII CTCAG 1 cut(s) 54
BseYI CCCAGC 1 cut(s) 38
Bsp143I GATC 4 cut(s) 24, 69, 88, 119
Bsp1720I GCTNAGC 1 cut(s) 63
BspCNI CTCAG 1 cut(s) 55
BssMI GATC 4 cut(s) 24, 69, 88, 119
Bst4CI ACNGT 1 cut(s) 126
BstDEI CTNAG 1 cut(s) 63
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 4 cut(s) 27, 72, 91, 122
BstMBI GATC 4 cut(s) 24, 69, 88, 119
BtsCI GGATG 1 cut(s) 10
Cfr13I GGNCC 1 cut(s) 129
CviAII CATG 1 cut(s) 96
CviJI RGCY 4 cut(s) 14, 38, 62, 67
CviKI_1 RGCY 4 cut(s) 14, 38, 62, 67
DdeI CTNAG 1 cut(s) 63
DpnI GATC 4 cut(s) 26, 71, 90, 121
DpnII GATC 4 cut(s) 24, 69, 88, 119
Eco47I GGWCC 1 cut(s) 129
FaeI CATG 1 cut(s) 99
FaiI YATR 1 cut(s) 97
FatI CATG 1 cut(s) 95
FbaI TGATCA 2 cut(s) 24, 69
FokI GGATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 142
GsaI CCCAGC 1 cut(s) 42
Hin1II CATG 1 cut(s) 99
Hpy166II GTNNAC 1 cut(s) 129
Hpy8I GTNNAC 1 cut(s) 129
HpyCH4III ACNGT 1 cut(s) 126
HpyF3I CTNAG 1 cut(s) 63
Hsp92II CATG 1 cut(s) 99
Ksp22I TGATCA 2 cut(s) 24, 69
Kzo9I GATC 4 cut(s) 24, 69, 88, 119
LpnPI CCDG 1 cut(s) 24
MaeI CTAG 1 cut(s) 142
MalI GATC 4 cut(s) 26, 71, 90, 121
MboI GATC 4 cut(s) 24, 69, 88, 119
MluCI AATT 1 cut(s) 20
MmeI TCCRAC 1 cut(s) 60
MnlI CCTC 1 cut(s) 93
MslI CAYNNNNRTG 1 cut(s) 100
NdeII GATC 4 cut(s) 24, 69, 88, 119
NlaIII CATG 1 cut(s) 99
PspFI CCCAGC 1 cut(s) 38
PspPI GGNCC 1 cut(s) 129
RseI CAYNNNNRTG 1 cut(s) 100
Sau3AI GATC 4 cut(s) 24, 69, 88, 119
Sau96I GGNCC 1 cut(s) 129
SetI ASST 6 cut(s) 40, 64, 69, 78, 104, 134
SgeI CNNG 6 cut(s) 43, 51, 85, 108, 124, 135
SinI GGWCC 1 cut(s) 129
SmiMI CAYNNNNRTG 1 cut(s) 100
Sse9I AATT 1 cut(s) 20
SspMI CTAG 1 cut(s) 142
TaaI ACNGT 1 cut(s) 126
TasI AATT 1 cut(s) 20
TspDTI ATGAA 1 cut(s) 84
VpaK11BI GGWCC 1 cut(s) 129
XspI CTAG 1 cut(s) 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.