RchiOBHm_Chr1g0327371

Signal recognition particle 14 kDa

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
16155950 .. 16156594
645 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 204 bp
ATGGATGAAATAACATTCCTTTCTCTGGTTTCAGAATCCTTGAAGTTCAAGGTGCAGAGGAATAAAATGAAAATTGTTGGTCAAGCAATTGACTACAGATGCCTTATCCGTGCAACTTATGGGAACATGACAATATCTACTTCGTTGCTAATGTTGGGTAAAACTCTGAGTTTAATTGATGCCCTTGTGTTGTTGTCCTACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

67

Amino Acids

7.56

Weight (kDa)

9.3

Isoelectric Point (pI)

18.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029649)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0327371 RchiOBHm_Chr7g0211671

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 25
AgsI TTSAA 2 cut(s) 43, 49
BfmI CTRYAG 1 cut(s) 94
BmsI GCATC 2 cut(s) 89, 169
Bsc4I CCNNNNNNNGG 1 cut(s) 25
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 1 cut(s) 25
BseMII CTCAG 1 cut(s) 158
BsgI GTGCAG 1 cut(s) 74
BslI CCNNNNNNNGG 1 cut(s) 25
BspCNI CTCAG 1 cut(s) 159
BstDEI CTNAG 1 cut(s) 167
BstF5I GGATG 1 cut(s) 10
BstSFI CTRYAG 1 cut(s) 94
BtsCI GGATG 1 cut(s) 10
CviAII CATG 1 cut(s) 127
DdeI CTNAG 1 cut(s) 167
FaeI CATG 1 cut(s) 130
FaiI YATR 2 cut(s) 120, 128
FatI CATG 1 cut(s) 126
FokI GGATG 1 cut(s) 17
Hin1II CATG 1 cut(s) 130
HinfI GANTC 1 cut(s) 35
Hpy188I TCNGA 2 cut(s) 34, 168
HpyCH4V TGCA 2 cut(s) 55, 113
HpyF3I CTNAG 1 cut(s) 167
Hsp92II CATG 1 cut(s) 130
LpnPI CCDG 1 cut(s) 11
LweI GCATC 2 cut(s) 89, 169
MfeI CAATTG 1 cut(s) 87
MluCI AATT 3 cut(s) 72, 87, 174
MnlI CCTC 1 cut(s) 51
MseI TTAA 1 cut(s) 173
MunI CAATTG 1 cut(s) 87
NlaIII CATG 1 cut(s) 130
PfeI GAWTC 1 cut(s) 35
SaqAI TTAA 1 cut(s) 173
SetI ASST 1 cut(s) 54
SfaNI GCATC 2 cut(s) 89, 169
SfcI CTRYAG 1 cut(s) 94
SgeI CNNG 7 cut(s) 38, 52, 61, 95, 122, 139, 197
Sse9I AATT 3 cut(s) 72, 87, 174
TasI AATT 3 cut(s) 72, 87, 174
TfiI GAWTC 1 cut(s) 35
Tru1I TTAA 1 cut(s) 173
Tru9I TTAA 1 cut(s) 173
TspDTI ATGAA 2 cut(s) 21, 83
TspGWI ACGGA 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.