RchiOBHm_Chr1g0328311

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
17661546 .. 17661765
220 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 135 bp
ATGACTGCACCTTTGGTGTTTACTGGACTGAATGCCATTTTAGTTTCAACCATTGCTCCTGTCTATGATTTTGTCTGCTTTCTTCCTTTTTGGGAAAGACGGCTGGTAATAATCGCATTAGAAAAATTTCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

44

Amino Acids

5.03

Weight (kDa)

5.94

Isoelectric Point (pI)

48.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 125
AgsI TTSAA 1 cut(s) 48
ApoI RAATTY 1 cut(s) 125
ArsI GACNNNNNNTTYG 1 cut(s) 27
Asp700I GAANNNNTTC 1 cut(s) 126
BceAI ACGGC 1 cut(s) 116
BsaXI ACNNNNNCTCC 2 cut(s) 40, 70
Bse1I ACTGG 1 cut(s) 28
Bse3DI GCAATG 1 cut(s) 51
BseMI GCAATG 1 cut(s) 51
BseNI ACTGG 1 cut(s) 28
BsmI GAATGC 1 cut(s) 37
BsrDI GCAATG 1 cut(s) 51
BsrI ACTGG 1 cut(s) 28
CviJI RGCY 1 cut(s) 103
CviKI_1 RGCY 1 cut(s) 103
FaiI YATR 1 cut(s) 66
Hpy166II GTNNAC 1 cut(s) 21
Hpy8I GTNNAC 1 cut(s) 21
HpyCH4V TGCA 1 cut(s) 8
LmnI GCTCC 1 cut(s) 61
LpnPI CCDG 3 cut(s) 9, 72, 89
MboII GAAGA 1 cut(s) 74
MluCI AATT 1 cut(s) 125
MroXI GAANNNNTTC 1 cut(s) 126
Mva1269I GAATGC 1 cut(s) 37
PctI GAATGC 1 cut(s) 37
PdmI GAANNNNTTC 1 cut(s) 126
SetI ASST 1 cut(s) 13
SgeI CNNG 3 cut(s) 36, 71, 116
Sse9I AATT 1 cut(s) 125
TasI AATT 1 cut(s) 125
XapI RAATTY 1 cut(s) 125
XmnI GAANNNNTTC 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.