RchiOBHm_Chr1g0333531

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
25674746 .. 25674925
180 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 180 bp
ATGGGACATATCCACCATGTCAATGTGGTTCAATTGGTTGGATTCTGCGCGGATGGATTTAGACGAGCTCTTGTTTATGACTTCTTACCTATTGGTTCACTACAAGAATTCTTTCATCAGCAGACAATAACAATTCTTTCCTGGGTTGGGGTAAGTTGCAAGTTATTTCTCTTGGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

59

Amino Acids

6.73

Weight (kDa)

6.38

Isoelectric Point (pI)

47.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 50
AciI CCGC 1 cut(s) 50
AcsI RAATTY 1 cut(s) 107
AfiI CCNNNNNNNGG 1 cut(s) 147
AgsI TTSAA 1 cut(s) 32
AjnI CCWGG 1 cut(s) 140
AluBI AGCT 1 cut(s) 68
AluI AGCT 1 cut(s) 68
Alw21I GWGCWC 1 cut(s) 70
ApoI RAATTY 1 cut(s) 107
Asp700I GAANNNNTTC 1 cut(s) 111
AspLEI GCGC 1 cut(s) 50
BanII GRGCYC 1 cut(s) 70
Bbv12I GWGCWC 1 cut(s) 70
BccI CCATC 1 cut(s) 47
BciT130I CCWGG 1 cut(s) 142
Bme1390I CCNGG 1 cut(s) 142
BmrFI CCNGG 1 cut(s) 142
BsaJI CCNNGG 1 cut(s) 141
Bsc4I CCNNNNNNNGG 1 cut(s) 147
BseBI CCWGG 1 cut(s) 142
BseDI CCNNGG 1 cut(s) 141
BseGI GGATG 1 cut(s) 58
BseLI CCNNNNNNNGG 1 cut(s) 147
Bsh1236I CGCG 1 cut(s) 50
BsiHKAI GWGCWC 1 cut(s) 70
BslFI GGGAC 1 cut(s) 18
BslI CCNNNNNNNGG 1 cut(s) 147
BsmFI GGGAC 1 cut(s) 18
Bsp1286I GDGCHC 1 cut(s) 70
BspACI CCGC 1 cut(s) 50
BspFNI CGCG 1 cut(s) 50
BssECI CCNNGG 1 cut(s) 141
Bst2UI CCWGG 1 cut(s) 142
BstF5I GGATG 1 cut(s) 58
BstFNI CGCG 1 cut(s) 50
BstHHI GCGC 1 cut(s) 50
BstNI CCWGG 1 cut(s) 142
BstSCI CCNGG 1 cut(s) 140
BstUI CGCG 1 cut(s) 50
BtsCI GGATG 1 cut(s) 58
CfoI GCGC 1 cut(s) 50
CviAII CATG 1 cut(s) 17
CviJI RGCY 1 cut(s) 68
CviKI_1 RGCY 1 cut(s) 68
Ecl136II GAGCTC 1 cut(s) 68
Eco24I GRGCYC 1 cut(s) 70
Eco53kI GAGCTC 1 cut(s) 68
EcoICRI GAGCTC 1 cut(s) 68
EcoRI GAATTC 1 cut(s) 107
EcoRII CCWGG 1 cut(s) 140
EcoT38I GRGCYC 1 cut(s) 70
FaeI CATG 1 cut(s) 20
FaiI YATR 3 cut(s) 9, 18, 78
FaqI GGGAC 1 cut(s) 18
FatI CATG 1 cut(s) 16
FokI GGATG 1 cut(s) 65
FriOI GRGCYC 1 cut(s) 70
GlaI GCGC 1 cut(s) 49
HhaI GCGC 1 cut(s) 50
Hin1II CATG 1 cut(s) 20
Hin6I GCGC 1 cut(s) 48
HinP1I GCGC 1 cut(s) 48
HinfI GANTC 1 cut(s) 42
Hpy166II GTNNAC 1 cut(s) 98
Hpy8I GTNNAC 1 cut(s) 98
HpyCH4V TGCA 1 cut(s) 159
Hsp92II CATG 1 cut(s) 20
HspAI GCGC 1 cut(s) 48
LpnPI CCDG 2 cut(s) 127, 154
MfeI CAATTG 1 cut(s) 32
MhlI GDGCHC 1 cut(s) 70
MluCI AATT 3 cut(s) 32, 107, 132
MmeI TCCRAC 1 cut(s) 19
MroXI GAANNNNTTC 1 cut(s) 111
MslI CAYNNNNRTG 1 cut(s) 21
MspR9I CCNGG 1 cut(s) 142
MunI CAATTG 1 cut(s) 32
MvaI CCWGG 1 cut(s) 142
MvnI CGCG 1 cut(s) 50
NlaIII CATG 1 cut(s) 20
PdmI GAANNNNTTC 1 cut(s) 111
PfeI GAWTC 1 cut(s) 42
Psp124BI GAGCTC 1 cut(s) 70
Psp6I CCWGG 1 cut(s) 140
PspGI CCWGG 1 cut(s) 140
RseI CAYNNNNRTG 1 cut(s) 21
SacI GAGCTC 1 cut(s) 70
ScrFI CCNGG 1 cut(s) 142
SduI GDGCHC 1 cut(s) 70
SetI ASST 2 cut(s) 70, 91
SgeI CNNG 8 cut(s) 29, 61, 77, 83, 116, 153, 154, 172
SmiMI CAYNNNNRTG 1 cut(s) 21
Sse9I AATT 3 cut(s) 32, 107, 132
SsiI CCGC 1 cut(s) 50
SstI GAGCTC 1 cut(s) 70
StyD4I CCNGG 1 cut(s) 140
TasI AATT 3 cut(s) 32, 107, 132
TfiI GAWTC 1 cut(s) 42
TspDTI ATGAA 1 cut(s) 104
XapI RAATTY 1 cut(s) 107
XmnI GAANNNNTTC 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.