RchiOBHm_Chr1g0336631
ERF Family

Belongs to the ABC transporter superfamily. ABCG family. PDR (TC 3.A.1.205) subfamily

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
28365064 .. 28366212
1149 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 168 bp
ATGTCAGAATATCGGTGTATTGCAACTTGCGAGCAAAGTGACATAGATTCTCCACAGCTTACAGTTGAAGAGTCAGTATATACTCATTACTCAGCTTGGTTATGCTTACCATCCCAGATTGCTAGAATTACTAGAACTGGAAGTCCCTTTAAATTCATAATTTCATAG

Protein Analysis

55

Amino Acids

6.27

Weight (kDa)

5.0

Isoelectric Point (pI)

82.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 152
AgsI TTSAA 1 cut(s) 68
AloI GAACNNNNNNTCC 2 cut(s) 127, 159
AluBI AGCT 2 cut(s) 58, 95
AluI AGCT 2 cut(s) 58, 95
ApoI RAATTY 1 cut(s) 152
BccI CCATC 1 cut(s) 118
BfaI CTAG 2 cut(s) 123, 132
Bse1I ACTGG 1 cut(s) 142
BseGI GGATG 1 cut(s) 110
BseMII CTCAG 1 cut(s) 105
BseNI ACTGG 1 cut(s) 142
BslFI GGGAC 1 cut(s) 129
BsmFI GGGAC 1 cut(s) 129
BspCNI CTCAG 1 cut(s) 104
BsrI ACTGG 1 cut(s) 142
Bst4CI ACNGT 1 cut(s) 64
Bst6I CTCTTC 1 cut(s) 63
BstC8I GCNNGC 1 cut(s) 32
BstDEI CTNAG 1 cut(s) 91
BstF5I GGATG 1 cut(s) 110
BtsCI GGATG 1 cut(s) 110
Cac8I GCNNGC 1 cut(s) 32
CviJI RGCY 2 cut(s) 58, 95
CviKI_1 RGCY 2 cut(s) 58, 95
DdeI CTNAG 1 cut(s) 91
DraI TTTAAA 1 cut(s) 151
Eam1104I CTCTTC 1 cut(s) 63
EarI CTCTTC 1 cut(s) 63
FaiI YATR 6 cut(s) 44, 79, 81, 103, 158, 166
FaqI GGGAC 1 cut(s) 129
FokI GGATG 1 cut(s) 97
FspBI CTAG 2 cut(s) 123, 132
FspEI CC 8 cut(s) 66, 82, 123, 123, 127, 128, 159, 160
HinfI GANTC 2 cut(s) 47, 71
Hpy188I TCNGA 1 cut(s) 7
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4V TGCA 1 cut(s) 23
HpyF3I CTNAG 1 cut(s) 91
LpnPI CCDG 2 cut(s) 123, 128
MaeI CTAG 2 cut(s) 123, 132
MaeIII GTNAC 1 cut(s) 38
MboII GAAGA 1 cut(s) 80
MluCI AATT 3 cut(s) 126, 152, 159
MlyI GAGTC 1 cut(s) 80
MseI TTAA 1 cut(s) 150
NmuCI GTSAC 1 cut(s) 38
PfeI GAWTC 1 cut(s) 47
PleI GAGTC 1 cut(s) 79
PpsI GAGTC 1 cut(s) 79
SaqAI TTAA 1 cut(s) 150
SchI GAGTC 1 cut(s) 80
SetI ASST 2 cut(s) 60, 97
SgeI CNNG 7 cut(s) 39, 43, 108, 127, 135, 144, 150
Sse9I AATT 3 cut(s) 126, 152, 159
SspMI CTAG 2 cut(s) 123, 132
TaaI ACNGT 1 cut(s) 64
TasI AATT 3 cut(s) 126, 152, 159
TfiI GAWTC 1 cut(s) 47
Tru1I TTAA 1 cut(s) 150
Tru9I TTAA 1 cut(s) 150
TseFI GTSAC 1 cut(s) 38
Tsp45I GTSAC 1 cut(s) 38
TspDTI ATGAA 2 cut(s) 145, 153
XapI RAATTY 1 cut(s) 152
XspI CTAG 2 cut(s) 123, 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.