Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

28536613 .. 28538202

Gene Structure 1590 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 138 bp

ATGGTGTTGTTTCTTACTCTGGCAATTCACCTGGACAGGGATGTTAGAGAGGCGTTTAAGGTGAATGCACAGTCACCTTCTTCCTGTCTTGGCAACAGCAGTCAAGGTAATCTTGTAATATATTCAATATATCGTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0006508 GO:0006518 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008235 GO:0008237 GO:0008238 GO:0009987 GO:0016787 GO:0019538 GO:0034641 GO:0042802 GO:0043170 GO:0043603 GO:0044237 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070006 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Peptidase_M18

Protein Analysis

45

Amino Acids

5.03

Weight (kDa)

7.96

Isoelectric Point (pI)

46.26

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfiI	CCNNNNNNNGG	1 cut(s)	37
AgsI	TTSAA	1 cut(s)	126
AjnI	CCWGG	1 cut(s)	30
AsuHPI	GGTGA	3 cut(s)	20, 66, 73
BciT130I	CCWGG	1 cut(s)	32
Bme1390I	CCNGG	1 cut(s)	32
BmrFI	CCNGG	1 cut(s)	32
Bsc4I	CCNNNNNNNGG	1 cut(s)	37
BseBI	CCWGG	1 cut(s)	32
BseGI	GGATG	1 cut(s)	46
BseLI	CCNNNNNNNGG	1 cut(s)	37
BslI	CCNNNNNNNGG	1 cut(s)	37
BsmI	GAATGC	1 cut(s)	70
Bst2UI	CCWGG	1 cut(s)	32
Bst4CI	ACNGT	1 cut(s)	72
BstF5I	GGATG	1 cut(s)	46
BstNI	CCWGG	1 cut(s)	32
BstSCI	CCNGG	1 cut(s)	30
BtsCI	GGATG	1 cut(s)	46
EcoRII	CCWGG	1 cut(s)	30
FaiI	YATR	2 cut(s)	121, 130
FalI	AAGNNNNNCTT	2 cut(s)	96, 128
FokI	GGATG	1 cut(s)	53
HphI	GGTGA	3 cut(s)	20, 66, 73
HpyAV	CCTTC	1 cut(s)	87
HpyCH4III	ACNGT	1 cut(s)	72
HpyCH4V	TGCA	1 cut(s)	68
LpnPI	CCDG	5 cut(s)	5, 17, 22, 44, 97
MaeIII	GTNAC	1 cut(s)	72
MboII	GAAGA	1 cut(s)	72
MluCI	AATT	1 cut(s)	24
MnlI	CCTC	1 cut(s)	43
MseI	TTAA	1 cut(s)	57
MspR9I	CCNGG	1 cut(s)	32
Mva1269I	GAATGC	1 cut(s)	70
MvaI	CCWGG	1 cut(s)	32
NmuCI	GTSAC	1 cut(s)	72
PctI	GAATGC	1 cut(s)	70
Psp6I	CCWGG	1 cut(s)	30
PspGI	CCWGG	1 cut(s)	30
SaqAI	TTAA	1 cut(s)	57
ScrFI	CCNGG	1 cut(s)	32
SetI	ASST	4 cut(s)	33, 63, 79, 109
SgeI	CNNG	8 cut(s)	32, 43, 44, 49, 96, 101, 116, 125
Sse9I	AATT	1 cut(s)	24
StyD4I	CCNGG	1 cut(s)	30
TaaI	ACNGT	1 cut(s)	72
TasI	AATT	1 cut(s)	24
Tru1I	TTAA	1 cut(s)	57
Tru9I	TTAA	1 cut(s)	57
TseFI	GTSAC	1 cut(s)	72
Tsp45I	GTSAC	1 cut(s)	72

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.