RchiOBHm_Chr1g0337101

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
28771066 .. 28771873
808 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 150 bp
ATGTTAGGATTTGTGGTTATGTTAATAATGATCTCAACTCAGCATGCATTATGTATATCCAGGAGGGCTGCTCACACTTCAGTGTACGATAAGAACCCTGATGAACAAATTTGCCCCAGCTTTGTCCACTGTGATCCCTACTCAACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.53

Weight (kDa)

6.21

Isoelectric Point (pI)

35.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 128
AcsI RAATTY 1 cut(s) 108
AcuI CTGAAG 1 cut(s) 63
AfaI GTAC 1 cut(s) 86
AjnI CCWGG 1 cut(s) 59
AleI CACNNNNGTG 1 cut(s) 80
AluBI AGCT 1 cut(s) 120
AluI AGCT 1 cut(s) 120
AlwI GGATC 1 cut(s) 128
ApeKI GCWGC 1 cut(s) 68
ApoI RAATTY 1 cut(s) 108
BbvI GCAGC 1 cut(s) 55
BciT130I CCWGG 1 cut(s) 61
BisI GCNGC 1 cut(s) 69
BlsI GCNGC 1 cut(s) 70
Bme1390I CCNGG 1 cut(s) 61
BmrFI CCNGG 1 cut(s) 61
BplI GAGNNNNNCTC 2 cut(s) 55, 87
BseBI CCWGG 1 cut(s) 61
BseMII CTCAG 1 cut(s) 53
BseXI GCAGC 1 cut(s) 55
BseYI CCCAGC 1 cut(s) 116
Bsp143I GATC 2 cut(s) 30, 133
BspCNI CTCAG 1 cut(s) 52
BspPI GGATC 1 cut(s) 128
BssMI GATC 2 cut(s) 30, 133
Bst2UI CCWGG 1 cut(s) 61
Bst4CI ACNGT 1 cut(s) 131
BstC8I GCNNGC 1 cut(s) 45
BstDEI CTNAG 1 cut(s) 39
BstKTI GATC 2 cut(s) 33, 136
BstMBI GATC 2 cut(s) 30, 133
BstNI CCWGG 1 cut(s) 61
BstNSI RCATGY 1 cut(s) 47
BstSCI CCNGG 1 cut(s) 59
BstV1I GCAGC 1 cut(s) 55
BtsIMutI CAGTG 2 cut(s) 87, 127
Cac8I GCNNGC 1 cut(s) 45
Csp6I GTAC 1 cut(s) 85
CviAII CATG 1 cut(s) 44
CviJI RGCY 2 cut(s) 68, 120
CviKI_1 RGCY 2 cut(s) 68, 120
CviQI GTAC 1 cut(s) 85
DdeI CTNAG 1 cut(s) 39
DpnI GATC 2 cut(s) 32, 135
DpnII GATC 2 cut(s) 30, 133
Eco57I CTGAAG 1 cut(s) 63
EcoRII CCWGG 1 cut(s) 59
EcoT22I ATGCAT 1 cut(s) 49
FaeI CATG 1 cut(s) 47
FaiI YATR 4 cut(s) 20, 45, 52, 56
FatI CATG 1 cut(s) 43
Fnu4HI GCNGC 1 cut(s) 69
Fsp4HI GCNGC 1 cut(s) 69
GluI GCNGC 1 cut(s) 69
GsaI CCCAGC 1 cut(s) 120
Hin1II CATG 1 cut(s) 47
Hpy166II GTNNAC 2 cut(s) 85, 127
Hpy8I GTNNAC 2 cut(s) 85, 127
HpyCH4III ACNGT 1 cut(s) 131
HpyCH4V TGCA 1 cut(s) 47
HpyF3I CTNAG 1 cut(s) 39
Hsp92II CATG 1 cut(s) 47
Kzo9I GATC 2 cut(s) 30, 133
LpnPI CCDG 4 cut(s) 46, 73, 111, 130
Lsp1109I GCAGC 1 cut(s) 55
MalI GATC 2 cut(s) 32, 135
MboI GATC 2 cut(s) 30, 133
MluCI AATT 1 cut(s) 108
MnlI CCTC 1 cut(s) 57
Mph1103I ATGCAT 1 cut(s) 49
MseI TTAA 1 cut(s) 23
MslI CAYNNNNRTG 1 cut(s) 80
MspR9I CCNGG 1 cut(s) 61
MvaI CCWGG 1 cut(s) 61
NdeII GATC 2 cut(s) 30, 133
NlaIII CATG 1 cut(s) 47
NsiI ATGCAT 1 cut(s) 49
NspI RCATGY 1 cut(s) 47
OliI CACNNNNGTG 1 cut(s) 80
PaeI GCATGC 1 cut(s) 47
PfoI TCCNGGA 1 cut(s) 59
PkrI GCNGC 1 cut(s) 70
Psp6I CCWGG 1 cut(s) 59
PspFI CCCAGC 1 cut(s) 116
PspGI CCWGG 1 cut(s) 59
RsaI GTAC 1 cut(s) 86
RsaNI GTAC 1 cut(s) 85
RseI CAYNNNNRTG 1 cut(s) 80
SaqAI TTAA 1 cut(s) 23
SatI GCNGC 1 cut(s) 69
Sau3AI GATC 2 cut(s) 30, 133
ScrFI CCNGG 1 cut(s) 61
SetI ASST 2 cut(s) 122, 149
SgeI CNNG 5 cut(s) 56, 72, 73, 110, 129
SmiMI CAYNNNNRTG 1 cut(s) 80
SphI GCATGC 1 cut(s) 47
Sse9I AATT 1 cut(s) 108
StyD4I CCNGG 1 cut(s) 59
TaaI ACNGT 1 cut(s) 131
TasI AATT 1 cut(s) 108
Tru1I TTAA 1 cut(s) 23
Tru9I TTAA 1 cut(s) 23
TscAI CASTG 2 cut(s) 87, 134
TseI GCWGC 1 cut(s) 68
TspDTI ATGAA 1 cut(s) 117
TspRI CASTG 2 cut(s) 87, 134
XapI RAATTY 1 cut(s) 108
XceI RCATGY 1 cut(s) 47
Zsp2I ATGCAT 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.