RchiOBHm_Chr1g0337281

squalene

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
28962121 .. 28962409
289 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 186 bp
ATGCCATTTTATGTTCCAATGTGGGTGGTGTTTTGTGCATCACCTGATTTGGCAAGACAGGAAATGCGCGAAGCATGTTTTGGCTATTTGTGCCTTGGAGATGAAAAGTTGTTGTGTACTTGTACAAACATGATTGATCTCTGGCTCTGTGGTAAGTGTTTGTGTTTCAAGAACAAACTGGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

7.08

Weight (kDa)

5.14

Isoelectric Point (pI)

60.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 69
AfaI GTAC 2 cut(s) 118, 124
AgsI TTSAA 1 cut(s) 169
AjuI GAANNNNNNNTTGG 2 cut(s) 63, 95
AspLEI GCGC 1 cut(s) 69
AsuHPI GGTGA 1 cut(s) 33
BmsI GCATC 1 cut(s) 47
BsaJI CCNNGG 1 cut(s) 94
Bse1I ACTGG 1 cut(s) 183
BseDI CCNNGG 1 cut(s) 94
BseNI ACTGG 1 cut(s) 183
Bsh1236I CGCG 1 cut(s) 69
Bsp1407I TGTACA 1 cut(s) 122
Bsp143I GATC 1 cut(s) 136
BspFNI CGCG 1 cut(s) 69
BsrGI TGTACA 1 cut(s) 122
BsrI ACTGG 1 cut(s) 183
BssECI CCNNGG 1 cut(s) 94
BssMI GATC 1 cut(s) 136
BssT1I CCWWGG 1 cut(s) 94
BstAUI TGTACA 1 cut(s) 122
BstFNI CGCG 1 cut(s) 69
BstHHI GCGC 1 cut(s) 69
BstKTI GATC 1 cut(s) 139
BstMBI GATC 1 cut(s) 136
BstMWI GCNNNNNNNGC 1 cut(s) 90
BstNSI RCATGY 1 cut(s) 78
BstUI CGCG 1 cut(s) 69
CfoI GCGC 1 cut(s) 69
Csp6I GTAC 2 cut(s) 117, 123
CspCI CAANNNNNGTGG 2 cut(s) 6, 41
CviAII CATG 2 cut(s) 75, 130
CviJI RGCY 2 cut(s) 84, 145
CviKI_1 RGCY 2 cut(s) 84, 145
CviQI GTAC 2 cut(s) 117, 123
DpnI GATC 1 cut(s) 138
DpnII GATC 1 cut(s) 136
Eco130I CCWWGG 1 cut(s) 94
EcoT14I CCWWGG 1 cut(s) 94
ErhI CCWWGG 1 cut(s) 94
FaeI CATG 2 cut(s) 78, 133
FaiI YATR 3 cut(s) 12, 76, 131
FatI CATG 2 cut(s) 74, 129
GlaI GCGC 1 cut(s) 68
HhaI GCGC 1 cut(s) 69
Hin1II CATG 2 cut(s) 78, 133
Hin6I GCGC 1 cut(s) 67
HinP1I GCGC 1 cut(s) 67
HphI GGTGA 1 cut(s) 33
Hpy166II GTNNAC 1 cut(s) 117
Hpy188III TCNNGA 1 cut(s) 169
Hpy8I GTNNAC 1 cut(s) 117
HpyCH4V TGCA 1 cut(s) 38
HpyF10VI GCNNNNNNNGC 1 cut(s) 90
Hsp92II CATG 2 cut(s) 78, 133
HspAI GCGC 1 cut(s) 67
Kzo9I GATC 1 cut(s) 136
LpnPI CCDG 4 cut(s) 44, 57, 127, 164
LweI GCATC 1 cut(s) 47
MalI GATC 1 cut(s) 138
MboI GATC 1 cut(s) 136
MseI TTAA 1 cut(s) 184
MvnI CGCG 1 cut(s) 69
MwoI GCNNNNNNNGC 1 cut(s) 90
NdeII GATC 1 cut(s) 136
NlaIII CATG 2 cut(s) 78, 133
NspI RCATGY 1 cut(s) 78
RsaI GTAC 2 cut(s) 118, 124
RsaNI GTAC 2 cut(s) 117, 123
SaqAI TTAA 1 cut(s) 184
Sau3AI GATC 1 cut(s) 136
SetI ASST 1 cut(s) 46
SfaNI GCATC 1 cut(s) 47
StyI CCWWGG 1 cut(s) 94
TatI WGTACW 2 cut(s) 116, 122
Tru1I TTAA 1 cut(s) 184
Tru9I TTAA 1 cut(s) 184
TspDTI ATGAA 1 cut(s) 117
XceI RCATGY 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.