RchiOBHm_Chr1g0337921

GMC oxidoreductase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
29897904 .. 29898056
153 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 153 bp
ATGGTGGAATCTAGATTAAGCATCTCTAAACCTGATTTGACTCCATGGTCGAATGTTGTTGCGACTAGCTTTCTTGAAGCTGGAATTTGCCCCTATAATGGTTTTAGTTTGGAGCATATTCAGGGACAAAGATTGGTGCTAGTTGTACGATAA

Protein Analysis

50

Amino Acids

5.56

Weight (kDa)

6.52

Isoelectric Point (pI)

20.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 46
AcsI RAATTY 1 cut(s) 84
AfaI GTAC 1 cut(s) 147
AfiI CCNNNNNNNGG 1 cut(s) 98
AgsI TTSAA 1 cut(s) 77
AluBI AGCT 2 cut(s) 69, 80
AluI AGCT 2 cut(s) 69, 80
ApoI RAATTY 1 cut(s) 84
BfaI CTAG 3 cut(s) 12, 66, 140
BmsI GCATC 1 cut(s) 30
BsaJI CCNNGG 1 cut(s) 44
Bsc4I CCNNNNNNNGG 1 cut(s) 98
BseDI CCNNGG 1 cut(s) 44
BseLI CCNNNNNNNGG 1 cut(s) 98
BslFI GGGAC 1 cut(s) 138
BslI CCNNNNNNNGG 1 cut(s) 98
BsmFI GGGAC 1 cut(s) 138
Bsp19I CCATGG 1 cut(s) 44
BssECI CCNNGG 1 cut(s) 44
BssT1I CCWWGG 1 cut(s) 44
BstDSI CCRYGG 1 cut(s) 44
BtgI CCRYGG 1 cut(s) 44
Csp6I GTAC 1 cut(s) 146
CviAII CATG 1 cut(s) 45
CviJI RGCY 2 cut(s) 69, 80
CviKI_1 RGCY 2 cut(s) 69, 80
CviQI GTAC 1 cut(s) 146
DrdI GACNNNNNNGTC 1 cut(s) 46
DseDI GACNNNNNNGTC 1 cut(s) 46
Eco130I CCWWGG 1 cut(s) 44
EcoT14I CCWWGG 1 cut(s) 44
ErhI CCWWGG 1 cut(s) 44
FaeI CATG 1 cut(s) 48
FaiI YATR 3 cut(s) 46, 96, 117
FaqI GGGAC 1 cut(s) 138
FatI CATG 1 cut(s) 44
FspBI CTAG 3 cut(s) 12, 66, 140
Hin1II CATG 1 cut(s) 48
HinfI GANTC 2 cut(s) 8, 40
Hpy188III TCNNGA 2 cut(s) 12, 74
Hsp92II CATG 1 cut(s) 48
LmnI GCTCC 1 cut(s) 112
LpnPI CCDG 3 cut(s) 45, 66, 107
LweI GCATC 1 cut(s) 30
MaeI CTAG 3 cut(s) 12, 66, 140
MluCI AATT 1 cut(s) 84
MlyI GAGTC 1 cut(s) 34
MseI TTAA 1 cut(s) 17
NcoI CCATGG 1 cut(s) 44
NlaIII CATG 1 cut(s) 48
PfeI GAWTC 1 cut(s) 8
PleI GAGTC 1 cut(s) 34
PpsI GAGTC 1 cut(s) 34
RsaI GTAC 1 cut(s) 147
RsaNI GTAC 1 cut(s) 146
SaqAI TTAA 1 cut(s) 17
SchI GAGTC 1 cut(s) 34
SetI ASST 3 cut(s) 34, 71, 82
SfaNI GCATC 1 cut(s) 30
SgeI CNNG 7 cut(s) 24, 44, 57, 78, 86, 93, 134
Sse9I AATT 1 cut(s) 84
SspMI CTAG 3 cut(s) 12, 66, 140
StyI CCWWGG 1 cut(s) 44
TaqI TCGA 1 cut(s) 50
TasI AATT 1 cut(s) 84
TfiI GAWTC 1 cut(s) 8
Tru1I TTAA 1 cut(s) 17
Tru9I TTAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 84
XbaI TCTAGA 1 cut(s) 11
XspI CTAG 3 cut(s) 12, 66, 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.