RchiOBHm_Chr1g0339681

Bifunctional monodehydroascorbate reductase and carbonic anhydrase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
31100765 .. 31101869
1105 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 237 bp
ATGATTTTGTATATCAAGGACAAGCTAGCGGAATTGGCCGAGGAGGTATGTAGAAGACATAAGGATGCTCACATTCCTCCCGAAAATATAGACATGAAGGAGTTTGATAAAAAAATAAAAAACCGCAAATATATTGGAGATCGATATTTTGGCTCTCTCTCTTCTCCTCCATGCACTGAGAATGTCATCTGGAACATCCTTGAAAAAGAGTTCTACGCAAAATATTTATTAGACTAA

Protein Analysis

78

Amino Acids

9.34

Weight (kDa)

6.73

Isoelectric Point (pI)

70.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Carb_anhydrase PF00194 9 - 71 1.2e-06 Eukaryotic-type carbonic anhydrase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 29, 124
AcoI YGGCCR 1 cut(s) 36
AgsI TTSAA 1 cut(s) 203
AluBI AGCT 1 cut(s) 25
AluI AGCT 1 cut(s) 25
AoxI GGCC 1 cut(s) 36
AsuNHI GCTAGC 1 cut(s) 25
BbsI GAAGAC 1 cut(s) 61
BfaI CTAG 1 cut(s) 26
BmsI GCATC 1 cut(s) 55
BmtI GCTAGC 1 cut(s) 29
BpiI GAAGAC 1 cut(s) 61
Bsa29I ATCGAT 1 cut(s) 142
BsaJI CCNNGG 1 cut(s) 39
BseCI ATCGAT 1 cut(s) 142
BseDI CCNNGG 1 cut(s) 39
BseGI GGATG 2 cut(s) 70, 195
BseMII CTCAG 1 cut(s) 168
BseRI GAGGAG 2 cut(s) 56, 156
BshFI GGCC 1 cut(s) 38
BshVI ATCGAT 1 cut(s) 142
BsnI GGCC 1 cut(s) 38
Bsp143I GATC 1 cut(s) 139
BspACI CCGC 2 cut(s) 29, 124
BspANI GGCC 1 cut(s) 38
BspCNI CTCAG 1 cut(s) 169
BspDI ATCGAT 1 cut(s) 142
BspOI GCTAGC 1 cut(s) 29
BssECI CCNNGG 1 cut(s) 39
BssMI GATC 1 cut(s) 139
Bst6I CTCTTC 1 cut(s) 166
BstC8I GCNNGC 1 cut(s) 27
BstDEI CTNAG 1 cut(s) 177
BstF5I GGATG 2 cut(s) 70, 195
BstKTI GATC 1 cut(s) 142
BstMBI GATC 1 cut(s) 139
BstMWI GCNNNNNNNGC 1 cut(s) 35
BstV2I GAAGAC 1 cut(s) 61
Bsu15I ATCGAT 1 cut(s) 142
BsuRI GGCC 1 cut(s) 38
BsuTUI ATCGAT 1 cut(s) 142
BtsCI GGATG 2 cut(s) 70, 195
BtsIMutI CAGTG 1 cut(s) 174
Cac8I GCNNGC 1 cut(s) 27
ClaI ATCGAT 1 cut(s) 142
CviAII CATG 2 cut(s) 94, 171
CviJI RGCY 3 cut(s) 25, 38, 153
CviKI_1 RGCY 3 cut(s) 25, 38, 153
DdeI CTNAG 1 cut(s) 177
DpnI GATC 1 cut(s) 141
DpnII GATC 1 cut(s) 139
EaeI YGGCCR 1 cut(s) 36
Eam1104I CTCTTC 1 cut(s) 166
EarI CTCTTC 1 cut(s) 166
FaeI CATG 2 cut(s) 97, 174
FaiI YATR 7 cut(s) 12, 49, 60, 89, 95, 132, 172
FatI CATG 2 cut(s) 93, 170
FokI GGATG 2 cut(s) 77, 182
FspBI CTAG 1 cut(s) 26
HaeIII GGCC 1 cut(s) 38
Hin1II CATG 2 cut(s) 97, 174
Hpy188III TCNNGA 2 cut(s) 80, 190
HpyAV CCTTC 1 cut(s) 91
HpyCH4V TGCA 1 cut(s) 174
HpyF10VI GCNNNNNNNGC 1 cut(s) 35
HpyF3I CTNAG 1 cut(s) 177
Hsp92II CATG 2 cut(s) 97, 174
Kzo9I GATC 1 cut(s) 139
LpnPI CCDG 1 cut(s) 175
LweI GCATC 1 cut(s) 55
MaeI CTAG 1 cut(s) 26
MalI GATC 1 cut(s) 141
MboI GATC 1 cut(s) 139
MboII GAAGA 2 cut(s) 66, 153
MluCI AATT 1 cut(s) 32
MnlI CCTC 4 cut(s) 34, 37, 87, 177
MslI CAYNNNNRTG 1 cut(s) 63
MwoI GCNNNNNNNGC 1 cut(s) 35
NdeII GATC 1 cut(s) 139
NheI GCTAGC 1 cut(s) 25
NlaIII CATG 2 cut(s) 97, 174
NmeAIII GCCGAG 1 cut(s) 64
RseI CAYNNNNRTG 1 cut(s) 63
Sau3AI GATC 1 cut(s) 139
SetI ASST 2 cut(s) 27, 48
SfaNI GCATC 1 cut(s) 55
SgeI CNNG 9 cut(s) 28, 34, 38, 52, 92, 106, 183, 202, 212
SmiMI CAYNNNNRTG 1 cut(s) 63
Sse9I AATT 1 cut(s) 32
SsiI CCGC 2 cut(s) 29, 124
SspI AATATT 1 cut(s) 224
SspMI CTAG 1 cut(s) 26
TaqI TCGA 1 cut(s) 142
TasI AATT 1 cut(s) 32
TscAI CASTG 1 cut(s) 181
TspDTI ATGAA 1 cut(s) 110
TspRI CASTG 1 cut(s) 181
XspI CTAG 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.