RchiOBHm_Chr1g0340041

membrane protein C776.05-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
31517717 .. 31518198
482 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 150 bp
ATGCCTCTGCAGGGGCCATTAGCATGGGCACTGATTGTTTGGCGTTGTAGCTTGGTTTTTAGTTCACTTGACAAATTAGTCAGTGTCCTGATACATCTTTTACCTGGTGAGCTGGTCCTTTCTTTATATACCTCTGAAACAAACTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.47

Weight (kDa)

5.43

Isoelectric Point (pI)

22.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF2838 PF10998 4 - 28 5.7e-07 Protein of unknown function (DUF2838)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 77
AfiI CCNNNNNNNGG 1 cut(s) 11
AjnI CCWGG 1 cut(s) 103
AluBI AGCT 2 cut(s) 51, 112
AluI AGCT 2 cut(s) 51, 112
AoxI GGCC 1 cut(s) 14
AspS9I GGNCC 2 cut(s) 14, 115
AsuHPI GGTGA 1 cut(s) 119
AvaII GGWCC 1 cut(s) 115
BaeGI GKGCMC 1 cut(s) 31
BciT130I CCWGG 1 cut(s) 105
BfaI CTAG 1 cut(s) 148
BfmI CTRYAG 1 cut(s) 8
Bme1390I CCNGG 1 cut(s) 105
Bme18I GGWCC 1 cut(s) 115
BmgT120I GGNCC 2 cut(s) 14, 115
BmiI GGNNCC 1 cut(s) 15
BmrFI CCNGG 1 cut(s) 105
Bsc4I CCNNNNNNNGG 1 cut(s) 11
BseBI CCWGG 1 cut(s) 105
BseLI CCNNNNNNNGG 1 cut(s) 11
BseSI GKGCMC 1 cut(s) 31
BshFI GGCC 1 cut(s) 16
BslI CCNNNNNNNGG 1 cut(s) 11
BsnI GGCC 1 cut(s) 16
Bsp1286I GDGCHC 1 cut(s) 31
BspANI GGCC 1 cut(s) 16
BspLI GGNNCC 1 cut(s) 15
BspMAI CTGCAG 1 cut(s) 12
Bst2UI CCWGG 1 cut(s) 105
BstNI CCWGG 1 cut(s) 105
BstSCI CCNGG 1 cut(s) 103
BstSFI CTRYAG 1 cut(s) 8
BstSLI GKGCMC 1 cut(s) 31
BstXI CCANNNNNNTGG 1 cut(s) 24
BsuRI GGCC 1 cut(s) 16
BtsIMutI CAGTG 2 cut(s) 29, 88
Cfr13I GGNCC 2 cut(s) 14, 115
CsiI ACCWGGT 1 cut(s) 103
CviAII CATG 1 cut(s) 24
CviJI RGCY 3 cut(s) 16, 51, 112
CviKI_1 RGCY 3 cut(s) 16, 51, 112
DrdI GACNNNNNNGTC 1 cut(s) 77
DseDI GACNNNNNNGTC 1 cut(s) 77
Eco47I GGWCC 1 cut(s) 115
EcoRII CCWGG 1 cut(s) 103
FaeI CATG 1 cut(s) 27
FaiI YATR 3 cut(s) 25, 127, 129
FatI CATG 1 cut(s) 23
FspBI CTAG 1 cut(s) 148
HaeIII GGCC 1 cut(s) 16
Hin1II CATG 1 cut(s) 27
HphI GGTGA 1 cut(s) 119
Hpy166II GTNNAC 1 cut(s) 65
Hpy188I TCNGA 1 cut(s) 136
Hpy188III TCNNGA 1 cut(s) 88
Hpy8I GTNNAC 1 cut(s) 65
HpyCH4V TGCA 1 cut(s) 10
Hsp92II CATG 1 cut(s) 27
LpnPI CCDG 4 cut(s) 90, 98, 101, 117
MabI ACCWGGT 1 cut(s) 103
MaeI CTAG 1 cut(s) 148
MhlI GDGCHC 1 cut(s) 31
MluCI AATT 1 cut(s) 74
MnlI CCTC 2 cut(s) 15, 142
MslI CAYNNNNRTG 1 cut(s) 22
MspR9I CCNGG 1 cut(s) 105
MvaI CCWGG 1 cut(s) 105
NlaIII CATG 1 cut(s) 27
NlaIV GGNNCC 1 cut(s) 15
Psp6I CCWGG 1 cut(s) 103
PspGI CCWGG 1 cut(s) 103
PspN4I GGNNCC 1 cut(s) 15
PspPI GGNCC 2 cut(s) 14, 115
PstI CTGCAG 1 cut(s) 12
RseI CAYNNNNRTG 1 cut(s) 22
Sau96I GGNCC 2 cut(s) 14, 115
ScrFI CCNGG 1 cut(s) 105
SduI GDGCHC 1 cut(s) 31
SetI ASST 4 cut(s) 53, 106, 114, 134
SexAI ACCWGGT 1 cut(s) 103
SfcI CTRYAG 1 cut(s) 8
SgeI CNNG 8 cut(s) 23, 36, 64, 80, 100, 116, 117, 125
SinI GGWCC 1 cut(s) 115
SmiMI CAYNNNNRTG 1 cut(s) 22
Sse9I AATT 1 cut(s) 74
SspMI CTAG 1 cut(s) 148
StyD4I CCNGG 1 cut(s) 103
TasI AATT 1 cut(s) 74
TscAI CASTG 2 cut(s) 36, 88
TspRI CASTG 2 cut(s) 36, 88
VpaK11BI GGWCC 1 cut(s) 115
XspI CTAG 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.