RchiOBHm_Chr1g0342031

oxidoreductase activity

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
33895789 .. 33896048
260 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 150 bp
ATGAATCCAAAGCCTTACCATGGTTACTTTGGGCAGTATATGCAAGTATTCGCTTGTTGGAGAGCTTTGGACTTGAAGATGCCTCCAACTATGACTCTGAGAAACTTCACAGAACTAATGTGGCCAAATGGTCATGACCAGTTTTGTTAG

Protein Analysis

49

Amino Acids

5.91

Weight (kDa)

7.83

Isoelectric Point (pI)

44.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 122
AfiI CCNNNNNNNGG 1 cut(s) 20
AgsI TTSAA 1 cut(s) 76
AluBI AGCT 1 cut(s) 65
AluI AGCT 1 cut(s) 65
AoxI GGCC 1 cut(s) 122
BalI TGGCCA 1 cut(s) 124
BmsI GCATC 1 cut(s) 69
BsaJI CCNNGG 1 cut(s) 19
Bsc4I CCNNNNNNNGG 1 cut(s) 20
Bse1I ACTGG 1 cut(s) 139
BseDI CCNNGG 1 cut(s) 19
BseLI CCNNNNNNNGG 1 cut(s) 20
BseMII CTCAG 1 cut(s) 89
BseNI ACTGG 1 cut(s) 139
BshFI GGCC 1 cut(s) 124
BslI CCNNNNNNNGG 1 cut(s) 20
BsnI GGCC 1 cut(s) 124
Bsp19I CCATGG 1 cut(s) 19
BspANI GGCC 1 cut(s) 124
BspCNI CTCAG 1 cut(s) 90
BspHI TCATGA 1 cut(s) 133
BsrI ACTGG 1 cut(s) 139
BssECI CCNNGG 1 cut(s) 19
BssT1I CCWWGG 1 cut(s) 19
BstAPI GCANNNNNTGC 1 cut(s) 40
BstDEI CTNAG 1 cut(s) 98
BstDSI CCRYGG 1 cut(s) 19
BstMWI GCNNNNNNNGC 1 cut(s) 40
BsuRI GGCC 1 cut(s) 124
BtgI CCRYGG 1 cut(s) 19
CciI TCATGA 1 cut(s) 133
CviAII CATG 2 cut(s) 20, 134
CviJI RGCY 3 cut(s) 13, 65, 124
CviKI_1 RGCY 3 cut(s) 13, 65, 124
DdeI CTNAG 1 cut(s) 98
EaeI YGGCCR 1 cut(s) 122
Eco130I CCWWGG 1 cut(s) 19
EcoT14I CCWWGG 1 cut(s) 19
ErhI CCWWGG 1 cut(s) 19
FaeI CATG 2 cut(s) 23, 137
FaiI YATR 5 cut(s) 21, 39, 41, 92, 135
FatI CATG 2 cut(s) 19, 133
HaeIII GGCC 1 cut(s) 124
Hin1II CATG 2 cut(s) 23, 137
HinfI GANTC 2 cut(s) 4, 94
Hpy188I TCNGA 1 cut(s) 99
Hpy188III TCNNGA 1 cut(s) 134
HpyCH4V TGCA 1 cut(s) 43
HpyF10VI GCNNNNNNNGC 1 cut(s) 40
HpyF3I CTNAG 1 cut(s) 98
Hsp92II CATG 2 cut(s) 23, 137
LweI GCATC 1 cut(s) 69
MaeIII GTNAC 1 cut(s) 23
MboII GAAGA 1 cut(s) 88
MlsI TGGCCA 1 cut(s) 124
MluNI TGGCCA 1 cut(s) 124
MlyI GAGTC 1 cut(s) 88
MmeI TCCRAC 2 cut(s) 38, 110
MnlI CCTC 1 cut(s) 93
Mox20I TGGCCA 1 cut(s) 124
MscI TGGCCA 1 cut(s) 124
Msp20I TGGCCA 1 cut(s) 124
MwoI GCNNNNNNNGC 1 cut(s) 40
NcoI CCATGG 1 cut(s) 19
NlaIII CATG 2 cut(s) 23, 137
PagI TCATGA 1 cut(s) 133
PfeI GAWTC 1 cut(s) 4
PleI GAGTC 1 cut(s) 88
PpsI GAGTC 1 cut(s) 88
SchI GAGTC 1 cut(s) 88
SetI ASST 1 cut(s) 67
SfaNI GCATC 1 cut(s) 69
SgeI CNNG 5 cut(s) 32, 56, 66, 85, 146
StyI CCWWGG 1 cut(s) 19
TfiI GAWTC 1 cut(s) 4
TspDTI ATGAA 1 cut(s) 17
XcmI CCANNNNNNNNNTGG 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.