RchiOBHm_Chr1g0343141

AT-rich interactive domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
35056754 .. 35060208
3455 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 156 bp
ATGGTTGATGATTTTTGTTCTATTCTTTGTAATGTTCTTAATTTAGTTTGTCATCTCATTTCACACCTCTATATGCAGGTTTATTTGGAGGTTCCAAATGGCAAAGAATTGGCAGTGGCACTTCAATCAAAGGGAATTCCTTACGTGATATATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

51

Amino Acids

5.77

Weight (kDa)

5.3

Isoelectric Point (pI)

30.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 67
AcsI RAATTY 1 cut(s) 135
AgsI TTSAA 1 cut(s) 125
ApoI RAATTY 1 cut(s) 135
BfuAI ACCTGC 1 cut(s) 67
BmiI GGNNCC 1 cut(s) 93
BsaAI YACGTR 1 cut(s) 145
BspLI GGNNCC 1 cut(s) 93
BspMI ACCTGC 1 cut(s) 67
BstBAI YACGTR 1 cut(s) 145
BtsI GCAGTG 1 cut(s) 120
BtsIMutI CAGTG 1 cut(s) 120
BveI ACCTGC 1 cut(s) 67
EcoRI GAATTC 1 cut(s) 135
FaiI YATR 3 cut(s) 72, 74, 151
HpyCH4IV ACGT 1 cut(s) 144
HpyCH4V TGCA 1 cut(s) 76
HpySE526I ACGT 1 cut(s) 144
LpnPI CCDG 1 cut(s) 62
MaeII ACGT 1 cut(s) 144
MluCI AATT 3 cut(s) 40, 107, 135
MnlI CCTC 2 cut(s) 77, 82
MseI TTAA 1 cut(s) 39
NlaIV GGNNCC 1 cut(s) 93
Ppu21I YACGTR 1 cut(s) 145
PspN4I GGNNCC 1 cut(s) 93
SaqAI TTAA 1 cut(s) 39
SetI ASST 4 cut(s) 69, 81, 93, 147
SgeI CNNG 1 cut(s) 89
Sse9I AATT 3 cut(s) 40, 107, 135
TaiI ACGT 1 cut(s) 147
TasI AATT 3 cut(s) 40, 107, 135
Tru1I TTAA 1 cut(s) 39
Tru9I TTAA 1 cut(s) 39
TscAI CASTG 1 cut(s) 120
TspRI CASTG 1 cut(s) 120
XapI RAATTY 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.