RchiOBHm_Chr1g0344201

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
36498291 .. 36498632
342 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 342 bp
ATGTCTTACAACAATTTGGAGGGCATGGTACCAACAAAAGGAATTTTCAAGAATGCAACTGCTACGTCAGTCGAAGGAAATAGTAAACTTTGTGATGGCATACCTGAATTTCAATTACTGAGGTGCAAGTTTCCACATCCAAGAAGGGGAGCATTGACCAAAACCTTGAAATGGATGATCTCTCTAATTTGTGGAATTCTTGGAGTCACTTTAGCAGTTTCTATTTTGTACAATTTTGTCTTACAGAGGGAAAATAAAGAGATTTGGGATTATGAATATTTCTGTATATCTCAAGAACGAGGTTACAAGCCATATATGTACAACTACTGTCCTCACATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

113

Amino Acids

13.08

Weight (kDa)

8.83

Isoelectric Point (pI)

40.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 28
AccB1I GGYRCC 1 cut(s) 28
AcsI RAATTY 3 cut(s) 42, 107, 195
AfaI GTAC 3 cut(s) 30, 230, 320
AfiI CCNNNNNNNGG 3 cut(s) 38, 146, 171
AgsI TTSAA 3 cut(s) 49, 113, 169
ApoI RAATTY 3 cut(s) 42, 107, 195
Asp718I GGTACC 1 cut(s) 28
BanI GGYRCC 1 cut(s) 28
BccI CCATC 1 cut(s) 89
BfaI CTAG 1 cut(s) 340
BmiI GGNNCC 1 cut(s) 30
BpuEI CTTGAG 1 cut(s) 276
Bsc4I CCNNNNNNNGG 3 cut(s) 38, 146, 171
BseGI GGATG 2 cut(s) 136, 180
BseLI CCNNNNNNNGG 3 cut(s) 38, 146, 171
BseMII CTCAG 1 cut(s) 110
BshNI GGYRCC 1 cut(s) 28
BslI CCNNNNNNNGG 3 cut(s) 38, 146, 171
BsmI GAATGC 1 cut(s) 58
Bsp1407I TGTACA 2 cut(s) 228, 318
Bsp143I GATC 1 cut(s) 177
BspCNI CTCAG 1 cut(s) 111
BspLI GGNNCC 1 cut(s) 30
BspT107I GGYRCC 1 cut(s) 28
BsrGI TGTACA 2 cut(s) 228, 318
BssMI GATC 1 cut(s) 177
Bst4CI ACNGT 1 cut(s) 329
BstAUI TGTACA 2 cut(s) 228, 318
BstDEI CTNAG 1 cut(s) 119
BstF5I GGATG 2 cut(s) 136, 180
BstKTI GATC 1 cut(s) 180
BstMBI GATC 1 cut(s) 177
BtsCI GGATG 2 cut(s) 136, 180
Csp6I GTAC 3 cut(s) 29, 229, 319
CviAII CATG 1 cut(s) 25
CviJI RGCY 1 cut(s) 310
CviKI_1 RGCY 1 cut(s) 310
CviQI GTAC 3 cut(s) 29, 229, 319
DdeI CTNAG 1 cut(s) 119
DpnI GATC 1 cut(s) 179
DpnII GATC 1 cut(s) 177
EcoRI GAATTC 1 cut(s) 195
FaeI CATG 1 cut(s) 28
FaiI YATR 7 cut(s) 26, 101, 273, 287, 313, 315, 317
FatI CATG 1 cut(s) 24
FokI GGATG 2 cut(s) 123, 187
FspBI CTAG 1 cut(s) 340
Hin1II CATG 1 cut(s) 28
HinfI GANTC 1 cut(s) 204
Hpy166II GTNNAC 1 cut(s) 86
Hpy188III TCNNGA 2 cut(s) 49, 293
Hpy8I GTNNAC 1 cut(s) 86
HpyAV CCTTC 2 cut(s) 68, 138
HpyCH4III ACNGT 1 cut(s) 329
HpyCH4IV ACGT 1 cut(s) 65
HpyCH4V TGCA 2 cut(s) 56, 126
HpyF3I CTNAG 1 cut(s) 119
HpySE526I ACGT 1 cut(s) 65
Hsp92II CATG 1 cut(s) 28
KpnI GGTACC 1 cut(s) 32
Kzo9I GATC 1 cut(s) 177
LmnI GCTCC 1 cut(s) 149
LpnPI CCDG 1 cut(s) 117
MaeI CTAG 1 cut(s) 340
MaeII ACGT 1 cut(s) 65
MaeIII GTNAC 2 cut(s) 205, 302
MalI GATC 1 cut(s) 179
MboI GATC 1 cut(s) 177
MluCI AATT 7 cut(s) 13, 42, 107, 113, 186, 195, 232
MlyI GAGTC 1 cut(s) 213
MnlI CCTC 5 cut(s) 13, 114, 240, 293, 342
Mva1269I GAATGC 1 cut(s) 58
NdeII GATC 1 cut(s) 177
NlaIII CATG 1 cut(s) 28
NlaIV GGNNCC 1 cut(s) 30
NmuCI GTSAC 1 cut(s) 205
PctI GAATGC 1 cut(s) 58
PleI GAGTC 1 cut(s) 212
PpsI GAGTC 1 cut(s) 212
PspN4I GGNNCC 1 cut(s) 30
RsaI GTAC 3 cut(s) 30, 230, 320
RsaNI GTAC 3 cut(s) 29, 229, 319
Sau3AI GATC 1 cut(s) 177
SchI GAGTC 1 cut(s) 213
SetI ASST 5 cut(s) 68, 106, 125, 167, 304
SmlI CTYRAG 1 cut(s) 291
SmoI CTYRAG 1 cut(s) 291
Sse9I AATT 7 cut(s) 13, 42, 107, 113, 186, 195, 232
SspI AATATT 1 cut(s) 278
SspMI CTAG 1 cut(s) 340
TaaI ACNGT 1 cut(s) 329
TaiI ACGT 1 cut(s) 68
TaqI TCGA 1 cut(s) 72
TasI AATT 7 cut(s) 13, 42, 107, 113, 186, 195, 232
TatI WGTACW 2 cut(s) 228, 318
TseFI GTSAC 1 cut(s) 205
Tsp45I GTSAC 1 cut(s) 205
TspDTI ATGAA 1 cut(s) 288
XapI RAATTY 3 cut(s) 42, 107, 195
XspI CTAG 1 cut(s) 340
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.