RchiOBHm_Chr1g0345011

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
37384237 .. 37385358
1122 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 288 bp
ATGACCAAACTTTCTCATTTGAGGTCGAGTTTGCAAAGTTATAACATAAGACAAGTGAGTGAGGGTGAAAGTATGGCTTCTGCTTTTAAGAGGCAACGAGATAGGAGGCTAACTTATGCTCATGAAGTTGAAAGTTATATTGTTGGGTTAGAGGAAAACACGGATAGACTGGTGAAAGAGTTGGTGGAAATTAAGTTTCCTTTGTTTATTAGTTCGATTGGGCTTGTCCATCGGACTTATGTTGTGGTTCTATTTTCAGCCTTTTGGGCTTGCTTTGGGGCAACTTAA

Protein Analysis

95

Amino Acids

10.96

Weight (kDa)

8.89

Isoelectric Point (pI)

55.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 42
AgsI TTSAA 1 cut(s) 131
AsuHPI GGTGA 2 cut(s) 77, 184
BccI CCATC 1 cut(s) 237
BglI GCCNNNNNGGC 1 cut(s) 266
Bse1I ACTGG 1 cut(s) 174
BseNI ACTGG 1 cut(s) 174
BspHI TCATGA 1 cut(s) 121
BsrI ACTGG 1 cut(s) 174
BstC8I GCNNGC 1 cut(s) 271
BstMWI GCNNNNNNNGC 1 cut(s) 266
Cac8I GCNNGC 1 cut(s) 271
CciI TCATGA 1 cut(s) 121
CviAII CATG 1 cut(s) 122
CviJI RGCY 5 cut(s) 77, 109, 223, 260, 269
CviKI_1 RGCY 5 cut(s) 77, 109, 223, 260, 269
FaeI CATG 1 cut(s) 125
FaiI YATR 7 cut(s) 42, 47, 74, 117, 123, 138, 240
FalI AAGNNNNNCTT 2 cut(s) 61, 93
FatI CATG 1 cut(s) 121
Hin1II CATG 1 cut(s) 125
HphI GGTGA 2 cut(s) 77, 184
Hpy188I TCNGA 1 cut(s) 234
Hpy188III TCNNGA 1 cut(s) 122
HpyCH4V TGCA 1 cut(s) 34
HpyF10VI GCNNNNNNNGC 1 cut(s) 266
Hsp92II CATG 1 cut(s) 125
LpnPI CCDG 1 cut(s) 155
MluCI AATT 1 cut(s) 189
MnlI CCTC 5 cut(s) 15, 55, 84, 99, 145
MseI TTAA 3 cut(s) 87, 192, 286
MwoI GCNNNNNNNGC 1 cut(s) 266
NlaIII CATG 1 cut(s) 125
PagI TCATGA 1 cut(s) 121
PsiI TTATAA 1 cut(s) 42
SaqAI TTAA 3 cut(s) 87, 192, 286
SetI ASST 1 cut(s) 26
SgeI CNNG 8 cut(s) 39, 65, 110, 134, 172, 182, 236, 282
Sse9I AATT 1 cut(s) 189
TaqI TCGA 2 cut(s) 26, 215
TasI AATT 1 cut(s) 189
Tru1I TTAA 3 cut(s) 87, 192, 286
Tru9I TTAA 3 cut(s) 87, 192, 286
TspDTI ATGAA 1 cut(s) 138
TspGWI ACGGA 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.