RchiOBHm_Chr1g0345021

This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
37404289 .. 37404471
183 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 183 bp
ATGGGCAAGGAAAAGGTCCATGTCAACATTGTGGTCATTGGCCATGTCAACTCTTGGAAGTCGACTACCACTAGTCATTTGATCTACAAGCTTGGGGGTATTGACAAGTGTGTGATTGAGAGGTCTGAGAATGAGGCTGTTGAGATGAACAAGCGAGGGGGGAGAGCGAGTGTGGTCATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

6.62

Weight (kDa)

9.36

Isoelectric Point (pI)

37.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GTP_EFTU PF00009 6 - 44 5.1e-07 Elongation factor Tu GTP binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 62
AcoI YGGCCR 1 cut(s) 40
AhlI ACTAGT 1 cut(s) 71
AluBI AGCT 1 cut(s) 91
AluI AGCT 1 cut(s) 91
AoxI GGCC 1 cut(s) 40
AspS9I GGNCC 1 cut(s) 16
AvaII GGWCC 1 cut(s) 16
BalI TGGCCA 1 cut(s) 42
BcuI ACTAGT 1 cut(s) 71
BfaI CTAG 1 cut(s) 72
Bme18I GGWCC 1 cut(s) 16
BmgT120I GGNCC 1 cut(s) 16
BsaXI ACNNNNNCTCC 1 cut(s) 154
BseMII CTCAG 1 cut(s) 117
BshFI GGCC 1 cut(s) 42
BsnI GGCC 1 cut(s) 42
Bsp143I GATC 1 cut(s) 81
BspANI GGCC 1 cut(s) 42
BspCNI CTCAG 1 cut(s) 118
BssMI GATC 1 cut(s) 81
BstDEI CTNAG 1 cut(s) 126
BstKTI GATC 1 cut(s) 84
BstMBI GATC 1 cut(s) 81
BsuRI GGCC 1 cut(s) 42
Cfr13I GGNCC 1 cut(s) 16
CviAII CATG 2 cut(s) 20, 44
CviJI RGCY 3 cut(s) 42, 91, 137
CviKI_1 RGCY 3 cut(s) 42, 91, 137
DdeI CTNAG 1 cut(s) 126
DpnI GATC 1 cut(s) 83
DpnII GATC 1 cut(s) 81
EaeI YGGCCR 1 cut(s) 40
Eco47I GGWCC 1 cut(s) 16
FaeI CATG 2 cut(s) 23, 47
FaiI YATR 2 cut(s) 21, 45
FatI CATG 2 cut(s) 19, 43
FblI GTMKAC 1 cut(s) 62
FspBI CTAG 1 cut(s) 72
HaeIII GGCC 1 cut(s) 42
Hin1II CATG 2 cut(s) 23, 47
HincII GTYRAC 3 cut(s) 25, 49, 63
HindII GTYRAC 3 cut(s) 25, 49, 63
HindIII AAGCTT 1 cut(s) 89
Hpy166II GTNNAC 3 cut(s) 25, 49, 63
Hpy188I TCNGA 1 cut(s) 127
Hpy8I GTNNAC 3 cut(s) 25, 49, 63
HpyF3I CTNAG 1 cut(s) 126
Hsp92II CATG 2 cut(s) 23, 47
Kzo9I GATC 1 cut(s) 81
MaeI CTAG 1 cut(s) 72
MalI GATC 1 cut(s) 83
MboI GATC 1 cut(s) 81
MlsI TGGCCA 1 cut(s) 42
MluNI TGGCCA 1 cut(s) 42
MnlI CCTC 3 cut(s) 114, 127, 149
Mox20I TGGCCA 1 cut(s) 42
MscI TGGCCA 1 cut(s) 42
Msp20I TGGCCA 1 cut(s) 42
NdeII GATC 1 cut(s) 81
NlaIII CATG 2 cut(s) 23, 47
PspPI GGNCC 1 cut(s) 16
SalI GTCGAC 1 cut(s) 61
Sau3AI GATC 1 cut(s) 81
Sau96I GGNCC 1 cut(s) 16
SetI ASST 3 cut(s) 18, 93, 125
SinI GGWCC 1 cut(s) 16
SpeI ACTAGT 1 cut(s) 71
SspMI CTAG 1 cut(s) 72
TaqI TCGA 1 cut(s) 62
TspDTI ATGAA 1 cut(s) 161
VpaK11BI GGWCC 1 cut(s) 16
XmiI GTMKAC 1 cut(s) 62
XspI CTAG 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.