RchiOBHm_Chr1g0345481
ERF Family

Belongs to the small GTPase superfamily. Rho family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
37800360 .. 37804100
3741 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 255 bp
ATGTGTTCTGTCTTCTCTTTTGACCTGTTGCATGTTATGTTGGAGAAGTGGGTTCCAAAGCTTAGACATTATGCCTCATCAGTGCCCATTATTCTCGTGGGAACTAAACTAGGTATACATTCTTTCCACTACCAAAACCAATTCAAATTGGATTTGATAGATATGCCTTTATTTTCCCTTAAGTTTCACTCTATGCTCACTATAATATATCTGCTATTTGTTTTCAAATTTATTGCTTCTTTCTTTCTTACATAA

Protein Analysis

84

Amino Acids

9.91

Weight (kDa)

9.25

Isoelectric Point (pI)

31.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 115
AcsI RAATTY 1 cut(s) 227
AflII CTTAAG 1 cut(s) 179
AgsI TTSAA 2 cut(s) 145, 226
AluBI AGCT 1 cut(s) 61
AluI AGCT 1 cut(s) 61
ApoI RAATTY 1 cut(s) 227
BaeGI GKGCMC 1 cut(s) 87
BauI CACGAG 1 cut(s) 95
BbsI GAAGAC 1 cut(s) 4
BfaI CTAG 1 cut(s) 110
BfrI CTTAAG 1 cut(s) 179
BmiI GGNNCC 1 cut(s) 54
BpiI GAAGAC 1 cut(s) 4
BseSI GKGCMC 1 cut(s) 87
Bsp1286I GDGCHC 1 cut(s) 87
BspLI GGNNCC 1 cut(s) 54
BspTI CTTAAG 1 cut(s) 179
BssNAI GTATAC 1 cut(s) 116
BssSI CACGAG 1 cut(s) 95
Bst1107I GTATAC 1 cut(s) 116
Bst2BI CACGAG 1 cut(s) 95
BstAFI CTTAAG 1 cut(s) 179
BstDEI CTNAG 1 cut(s) 62
BstNSI RCATGY 1 cut(s) 35
BstSLI GKGCMC 1 cut(s) 87
BstV2I GAAGAC 1 cut(s) 4
BstZ17I GTATAC 1 cut(s) 116
BtsIMutI CAGTG 1 cut(s) 87
CviAII CATG 1 cut(s) 32
CviJI RGCY 1 cut(s) 61
CviKI_1 RGCY 1 cut(s) 61
DdeI CTNAG 1 cut(s) 62
FaeI CATG 1 cut(s) 35
FaiI YATR 9 cut(s) 33, 38, 72, 116, 164, 194, 203, 208, 253
FatI CATG 1 cut(s) 31
FblI GTMKAC 1 cut(s) 115
FspBI CTAG 1 cut(s) 110
Hin1II CATG 1 cut(s) 35
HindIII AAGCTT 1 cut(s) 59
Hpy166II GTNNAC 1 cut(s) 116
Hpy8I GTNNAC 1 cut(s) 116
HpyCH4V TGCA 1 cut(s) 31
HpyF3I CTNAG 1 cut(s) 62
Hsp92II CATG 1 cut(s) 35
LpnPI CCDG 1 cut(s) 38
MaeI CTAG 1 cut(s) 110
MboII GAAGA 1 cut(s) 4
MhlI GDGCHC 1 cut(s) 87
MluCI AATT 3 cut(s) 140, 146, 227
MmeI TCCRAC 1 cut(s) 21
MnlI CCTC 1 cut(s) 85
MseI TTAA 1 cut(s) 180
MspCI CTTAAG 1 cut(s) 179
NlaIII CATG 1 cut(s) 35
NlaIV GGNNCC 1 cut(s) 54
NspI RCATGY 1 cut(s) 35
PspN4I GGNNCC 1 cut(s) 54
SaqAI TTAA 1 cut(s) 180
SduI GDGCHC 1 cut(s) 87
SetI ASST 3 cut(s) 27, 63, 115
SgeI CNNG 5 cut(s) 37, 44, 107, 109, 122
SmlI CTYRAG 1 cut(s) 179
SmoI CTYRAG 1 cut(s) 179
Sse9I AATT 3 cut(s) 140, 146, 227
SspMI CTAG 1 cut(s) 110
TasI AATT 3 cut(s) 140, 146, 227
Tru1I TTAA 1 cut(s) 180
Tru9I TTAA 1 cut(s) 180
TscAI CASTG 1 cut(s) 87
TspRI CASTG 1 cut(s) 87
Vha464I CTTAAG 1 cut(s) 179
XapI RAATTY 1 cut(s) 227
XceI RCATGY 1 cut(s) 35
XcmI CCANNNNNNNNNTGG 1 cut(s) 94
XmiI GTMKAC 1 cut(s) 115
XspI CTAG 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.