RchiOBHm_Chr1g0348661

plastid-lipid-associated protein 11

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
41589990 .. 41593587
3598 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 150 bp
ATGAAGATGAGGAAGTTTGCTAGACTTCTGTTGGTGGGATATCAATTAATGTTTGAAACTGTATACCTTGATGACGAGATTCGGGTTGTGAAGGATATCAGAGAAGACTATTTGGTTGTAGACCGTGCTCCCTATGCTTGGACAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

6.0

Weight (kDa)

5.28

Isoelectric Point (pI)

22.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 63, 120
AfiI CCNNNNNNNGG 1 cut(s) 138
AgsI TTSAA 1 cut(s) 56
Alw21I GWGCWC 1 cut(s) 130
AseI ATTAAT 1 cut(s) 47
BbsI GAAGAC 1 cut(s) 111
Bbv12I GWGCWC 1 cut(s) 130
BfaI CTAG 1 cut(s) 21
BpiI GAAGAC 1 cut(s) 111
Bsc4I CCNNNNNNNGG 1 cut(s) 138
BseLI CCNNNNNNNGG 1 cut(s) 138
BsiHKAI GWGCWC 1 cut(s) 130
BslI CCNNNNNNNGG 1 cut(s) 138
Bsp1286I GDGCHC 1 cut(s) 130
BssNAI GTATAC 1 cut(s) 64
Bst1107I GTATAC 1 cut(s) 64
Bst4CI ACNGT 2 cut(s) 61, 125
BstMWI GCNNNNNNNGC 1 cut(s) 134
BstV2I GAAGAC 1 cut(s) 111
BstZ17I GTATAC 1 cut(s) 64
Eco32I GATATC 2 cut(s) 41, 97
EcoRV GATATC 2 cut(s) 41, 97
FaiI YATR 2 cut(s) 64, 135
FblI GTMKAC 2 cut(s) 63, 120
FspBI CTAG 1 cut(s) 21
HinfI GANTC 1 cut(s) 79
Hpy166II GTNNAC 2 cut(s) 64, 121
Hpy188I TCNGA 1 cut(s) 101
Hpy8I GTNNAC 2 cut(s) 64, 121
HpyAV CCTTC 1 cut(s) 85
HpyCH4III ACNGT 2 cut(s) 61, 125
HpyF10VI GCNNNNNNNGC 1 cut(s) 134
LmnI GCTCC 1 cut(s) 133
MaeI CTAG 1 cut(s) 21
MboII GAAGA 2 cut(s) 16, 116
MhlI GDGCHC 1 cut(s) 130
MluCI AATT 1 cut(s) 44
MnlI CCTC 1 cut(s) 3
MseI TTAA 1 cut(s) 47
MwoI GCNNNNNNNGC 1 cut(s) 134
PfeI GAWTC 1 cut(s) 79
PshBI ATTAAT 1 cut(s) 47
SaqAI TTAA 1 cut(s) 47
SduI GDGCHC 1 cut(s) 130
SetI ASST 1 cut(s) 69
SgeI CNNG 5 cut(s) 33, 80, 88, 95, 137
Sse9I AATT 1 cut(s) 44
SspMI CTAG 1 cut(s) 21
TaaI ACNGT 2 cut(s) 61, 125
TasI AATT 1 cut(s) 44
TfiI GAWTC 1 cut(s) 79
Tru1I TTAA 1 cut(s) 47
Tru9I TTAA 1 cut(s) 47
TspDTI ATGAA 1 cut(s) 17
VspI ATTAAT 1 cut(s) 47
XmiI GTMKAC 2 cut(s) 63, 120
XspI CTAG 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.