RchiOBHm_Chr1g0349061

Holliday junction resolvase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
42096932 .. 42097816
885 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 141 bp
ATGATGGTGCTGGAGCGATATTTCTCCATGTCAGGTGAAGGAACTGAGCTTGTACTGCCCAAGAACTTGGATCTGCAAGACAGACTTAGAAGAGGTCCACCCAAAGACGTTGATTACTTCTCTGAAGATAATGAGGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

46

Amino Acids

5.41

Weight (kDa)

4.41

Isoelectric Point (pI)

59.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 78
AfaI GTAC 1 cut(s) 54
AluBI AGCT 1 cut(s) 49
AluI AGCT 1 cut(s) 49
AlwI GGATC 1 cut(s) 78
AspS9I GGNCC 1 cut(s) 95
AsuHPI GGTGA 1 cut(s) 47
AvaII GGWCC 1 cut(s) 95
Bme18I GGWCC 1 cut(s) 95
BmgT120I GGNCC 1 cut(s) 95
BpmI CTGGAG 1 cut(s) 32
BseMII CTCAG 1 cut(s) 36
Bsp143I GATC 1 cut(s) 70
BspCNI CTCAG 1 cut(s) 37
BspPI GGATC 1 cut(s) 78
BssMI GATC 1 cut(s) 70
Bst6I CTCTTC 1 cut(s) 85
BstDEI CTNAG 2 cut(s) 45, 86
BstKTI GATC 1 cut(s) 73
BstMBI GATC 1 cut(s) 70
BstMWI GCNNNNNNNGC 1 cut(s) 55
BstX2I RGATCY 1 cut(s) 70
BstXI CCANNNNNNTGG 1 cut(s) 67
BstYI RGATCY 1 cut(s) 70
Cfr13I GGNCC 1 cut(s) 95
Csp6I GTAC 1 cut(s) 53
CviAII CATG 1 cut(s) 28
CviJI RGCY 1 cut(s) 49
CviKI_1 RGCY 1 cut(s) 49
CviQI GTAC 1 cut(s) 53
DdeI CTNAG 2 cut(s) 45, 86
DpnI GATC 1 cut(s) 72
DpnII GATC 1 cut(s) 70
Eam1104I CTCTTC 1 cut(s) 85
EarI CTCTTC 1 cut(s) 85
Eco47I GGWCC 1 cut(s) 95
FaeI CATG 1 cut(s) 31
FaiI YATR 1 cut(s) 29
FalI AAGNNNNNCTT 2 cut(s) 69, 101
FatI CATG 1 cut(s) 27
GsuI CTGGAG 1 cut(s) 32
Hin1II CATG 1 cut(s) 31
HphI GGTGA 1 cut(s) 47
Hpy166II GTNNAC 1 cut(s) 98
Hpy188I TCNGA 1 cut(s) 124
Hpy8I GTNNAC 1 cut(s) 98
HpyAV CCTTC 1 cut(s) 32
HpyCH4IV ACGT 1 cut(s) 108
HpyCH4V TGCA 1 cut(s) 76
HpyF10VI GCNNNNNNNGC 1 cut(s) 55
HpyF3I CTNAG 2 cut(s) 45, 86
HpySE526I ACGT 1 cut(s) 108
Hsp92II CATG 1 cut(s) 31
Kzo9I GATC 1 cut(s) 70
LmnI GCTCC 1 cut(s) 13
LpnPI CCDG 1 cut(s) 18
MaeII ACGT 1 cut(s) 108
MalI GATC 1 cut(s) 72
MboI GATC 1 cut(s) 70
MboII GAAGA 2 cut(s) 102, 137
MflI RGATCY 1 cut(s) 70
MnlI CCTC 2 cut(s) 86, 127
MwoI GCNNNNNNNGC 1 cut(s) 55
NdeII GATC 1 cut(s) 70
NlaIII CATG 1 cut(s) 31
PspPI GGNCC 1 cut(s) 95
PsuI RGATCY 1 cut(s) 70
RsaI GTAC 1 cut(s) 54
RsaNI GTAC 1 cut(s) 53
Sau3AI GATC 1 cut(s) 70
Sau96I GGNCC 1 cut(s) 95
SetI ASST 4 cut(s) 37, 51, 97, 111
SgeI CNNG 7 cut(s) 23, 40, 45, 62, 73, 79, 89
SinI GGWCC 1 cut(s) 95
TaiI ACGT 1 cut(s) 111
TatI WGTACW 1 cut(s) 52
VpaK11BI GGWCC 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.