RchiOBHm_Chr1g0349871

Required for the formation of a threonylcarbamoyl group on adenosine at position 37 (t(6)A37) in mitochondrial tRNAs that read codons beginning with adenine. Probably involved in the transfer of the threonylcarbamoyl moiety of threonylcarbamoyl-AMP (TC-AMP) to the N6 group of A37. Involved in mitochondrial genome maintenance

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
42961638 .. 42963169
1532 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 177 bp
ATGCCCGTTGCAGTTGTGTCTGGTGGTGTTGCATCTAATCAATATGTTCGAGCTCGACTTGATCAGGTTGTCAAGAAAAACAACTTACAACTTGTATGCCTTCCTCCCAGTCTTTGTACAGACAATGGTAATTCATTTTATTTAGTTTTGGCTCAACTTGTGGTGTTGGTGATGTGA

Protein Analysis

58

Amino Acids

6.25

Weight (kDa)

8.8

Isoelectric Point (pI)

44.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 118
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
Alw21I GWGCWC 1 cut(s) 55
BanII GRGCYC 1 cut(s) 55
Bbv12I GWGCWC 1 cut(s) 55
BclI TGATCA 1 cut(s) 61
BmrI ACTGGG 1 cut(s) 102
BmsI GCATC 1 cut(s) 41
BmuI ACTGGG 1 cut(s) 102
Bse1I ACTGG 1 cut(s) 108
BseNI ACTGG 1 cut(s) 108
BsiHKAI GWGCWC 1 cut(s) 55
Bsp1286I GDGCHC 1 cut(s) 55
Bsp1407I TGTACA 1 cut(s) 116
Bsp143I GATC 1 cut(s) 61
BsrGI TGTACA 1 cut(s) 116
BsrI ACTGG 1 cut(s) 108
BssMI GATC 1 cut(s) 61
BstAUI TGTACA 1 cut(s) 116
BstKTI GATC 1 cut(s) 64
BstMBI GATC 1 cut(s) 61
Csp6I GTAC 1 cut(s) 117
CviJI RGCY 2 cut(s) 53, 152
CviKI_1 RGCY 2 cut(s) 53, 152
CviQI GTAC 1 cut(s) 117
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
Ecl136II GAGCTC 1 cut(s) 53
Eco24I GRGCYC 1 cut(s) 55
Eco53kI GAGCTC 1 cut(s) 53
EcoICRI GAGCTC 1 cut(s) 53
EcoT38I GRGCYC 1 cut(s) 55
FaiI YATR 2 cut(s) 45, 97
FbaI TGATCA 1 cut(s) 61
FriOI GRGCYC 1 cut(s) 55
Hpy188III TCNNGA 1 cut(s) 73
HpyAV CCTTC 1 cut(s) 110
HpyCH4V TGCA 2 cut(s) 11, 32
Ksp22I TGATCA 1 cut(s) 61
Kzo9I GATC 1 cut(s) 61
LpnPI CCDG 3 cut(s) 6, 50, 121
LweI GCATC 1 cut(s) 41
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MhlI GDGCHC 1 cut(s) 55
MluCI AATT 1 cut(s) 130
MnlI CCTC 1 cut(s) 114
NdeII GATC 1 cut(s) 61
Psp124BI GAGCTC 1 cut(s) 55
RsaI GTAC 1 cut(s) 118
RsaNI GTAC 1 cut(s) 117
SacI GAGCTC 1 cut(s) 55
Sau3AI GATC 1 cut(s) 61
SduI GDGCHC 1 cut(s) 55
SetI ASST 2 cut(s) 55, 69
SfaNI GCATC 1 cut(s) 41
Sse9I AATT 1 cut(s) 130
SstI GAGCTC 1 cut(s) 55
TaqI TCGA 2 cut(s) 49, 55
TasI AATT 1 cut(s) 130
TatI WGTACW 1 cut(s) 116
TspDTI ATGAA 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.