Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

46812721 .. 46814063

Gene Structure 1343 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 192 bp

ATGCTCTTTTTGGAGACACCAATTGGAGTTGGGTTCTCTTATTCAACTGATACCGCTTCTTATGAGTCTGTAAATGATCATATTACAGTTTGGTCCAGGTATTCATGCGCCTGGCTTACAGCTCCGCCTCCGCCCCGCCCATGGCGTTTATTAACTTGGAGGGTAGGATTGCGGAGGTCGACGCGTCGATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004180 GO:0004185 GO:0005575 GO:0005618 GO:0005623 GO:0005911 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008236 GO:0008238 GO:0009056 GO:0009057 GO:0009505 GO:0009506 GO:0009987 GO:0016787 GO:0017171 GO:0019538 GO:0030054 GO:0030163 GO:0030312 GO:0043170 GO:0044237 GO:0044238 GO:0044248 GO:0044257 GO:0044260 GO:0044265 GO:0044267 GO:0044464 GO:0051603 GO:0055044 GO:0070008 GO:0070011 GO:0071704 GO:0071944 GO:0140096 GO:1901564 GO:1901565 GO:1901575

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Peptidase_S10

Protein Analysis

63

Amino Acids

7.36

Weight (kDa)

10.25

Isoelectric Point (pI)

62.05

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	179
AccII	CGCG	1 cut(s)	184
AciI	CCGC	5 cut(s)	54, 125, 131, 136, 172
AfiI	CCNNNNNNNGG	1 cut(s)	141
AflIII	ACRYGT	1 cut(s)	182
AgsI	TTSAA	1 cut(s)	45
AjnI	CCWGG	2 cut(s)	95, 110
AluBI	AGCT	1 cut(s)	122
AluI	AGCT	1 cut(s)	122
Alw26I	GTCTC	1 cut(s)	8
AspLEI	GCGC	1 cut(s)	110
AspS9I	GGNCC	1 cut(s)	93
AvaII	GGWCC	1 cut(s)	93
BciT130I	CCWGG	2 cut(s)	97, 112
BclI	TGATCA	1 cut(s)	76
BcoDI	GTCTC	1 cut(s)	8
Bme1390I	CCNGG	2 cut(s)	97, 112
Bme18I	GGWCC	1 cut(s)	93
BmgT120I	GGNCC	1 cut(s)	93
BmrFI	CCNGG	2 cut(s)	97, 112
BsaJI	CCNNGG	1 cut(s)	140
Bsc4I	CCNNNNNNNGG	1 cut(s)	141
BseBI	CCWGG	2 cut(s)	97, 112
BseDI	CCNNGG	1 cut(s)	140
BseLI	CCNNNNNNNGG	1 cut(s)	141
Bsh1236I	CGCG	1 cut(s)	184
BslI	CCNNNNNNNGG	1 cut(s)	141
BsmAI	GTCTC	1 cut(s)	8
Bsp143I	GATC	1 cut(s)	76
Bsp19I	CCATGG	1 cut(s)	140
BspACI	CCGC	5 cut(s)	54, 125, 131, 136, 172
BspFNI	CGCG	1 cut(s)	184
BssECI	CCNNGG	1 cut(s)	140
BssMI	GATC	1 cut(s)	76
BssT1I	CCWWGG	1 cut(s)	140
Bst2UI	CCWGG	2 cut(s)	97, 112
Bst4CI	ACNGT	1 cut(s)	88
BstDSI	CCRYGG	1 cut(s)	140
BstFNI	CGCG	1 cut(s)	184
BstHHI	GCGC	1 cut(s)	110
BstKTI	GATC	1 cut(s)	79
BstMAI	GTCTC	1 cut(s)	8
BstMBI	GATC	1 cut(s)	76
BstNI	CCWGG	2 cut(s)	97, 112
BstSCI	CCNGG	2 cut(s)	95, 110
BstUI	CGCG	1 cut(s)	184
BtgI	CCRYGG	1 cut(s)	140
CfoI	GCGC	1 cut(s)	110
Cfr13I	GGNCC	1 cut(s)	93
CseI	GACGC	1 cut(s)	173
CviAII	CATG	2 cut(s)	105, 141
CviJI	RGCY	2 cut(s)	115, 122
CviKI_1	RGCY	2 cut(s)	115, 122
DpnI	GATC	1 cut(s)	78
DpnII	GATC	1 cut(s)	76
EciI	GGCGGA	2 cut(s)	114, 120
Eco130I	CCWWGG	1 cut(s)	140
Eco47I	GGWCC	1 cut(s)	93
EcoRII	CCWGG	2 cut(s)	95, 110
EcoT14I	CCWWGG	1 cut(s)	140
ErhI	CCWWGG	1 cut(s)	140
FaeI	CATG	2 cut(s)	108, 144
FaiI	YATR	4 cut(s)	63, 81, 106, 142
FatI	CATG	2 cut(s)	104, 140
FauI	CCCGC	1 cut(s)	143
FbaI	TGATCA	1 cut(s)	76
FblI	GTMKAC	1 cut(s)	179
GlaI	GCGC	1 cut(s)	109
HgaI	GACGC	1 cut(s)	173
HhaI	GCGC	1 cut(s)	110
Hin1II	CATG	2 cut(s)	108, 144
Hin6I	GCGC	1 cut(s)	108
HinP1I	GCGC	1 cut(s)	108
HincII	GTYRAC	1 cut(s)	180
HindII	GTYRAC	1 cut(s)	180
HinfI	GANTC	1 cut(s)	65
Hpy166II	GTNNAC	1 cut(s)	180
Hpy8I	GTNNAC	1 cut(s)	180
Hpy99I	CGWCG	2 cut(s)	184, 189
HpyCH4III	ACNGT	1 cut(s)	88
Hsp92II	CATG	2 cut(s)	108, 144
HspAI	GCGC	1 cut(s)	108
Ksp22I	TGATCA	1 cut(s)	76
Kzo9I	GATC	1 cut(s)	76
LmnI	GCTCC	1 cut(s)	127
LpnPI	CCDG	4 cut(s)	82, 97, 109, 124
MalI	GATC	1 cut(s)	78
MboI	GATC	1 cut(s)	76
MfeI	CAATTG	1 cut(s)	21
MluCI	AATT	1 cut(s)	21
MluI	ACGCGT	1 cut(s)	182
MlyI	GAGTC	1 cut(s)	74
MnlI	CCTC	3 cut(s)	138, 153, 168
MseI	TTAA	1 cut(s)	152
MspR9I	CCNGG	2 cut(s)	97, 112
MunI	CAATTG	1 cut(s)	21
MvaI	CCWGG	2 cut(s)	97, 112
MvnI	CGCG	1 cut(s)	184
NcoI	CCATGG	1 cut(s)	140
NdeII	GATC	1 cut(s)	76
NlaIII	CATG	2 cut(s)	108, 144
PleI	GAGTC	1 cut(s)	73
PpsI	GAGTC	1 cut(s)	73
Psp6I	CCWGG	2 cut(s)	95, 110
PspGI	CCWGG	2 cut(s)	95, 110
PspPI	GGNCC	1 cut(s)	93
SalI	GTCGAC	1 cut(s)	178
SaqAI	TTAA	1 cut(s)	152
Sau3AI	GATC	1 cut(s)	76
Sau96I	GGNCC	1 cut(s)	93
SchI	GAGTC	1 cut(s)	74
ScrFI	CCNGG	2 cut(s)	97, 112
SetI	ASST	3 cut(s)	101, 124, 179
SgeI	CNNG	8 cut(s)	108, 109, 117, 123, 124, 147, 153, 168
SinI	GGWCC	1 cut(s)	93
Sse9I	AATT	1 cut(s)	21
SsiI	CCGC	5 cut(s)	54, 125, 131, 136, 172
StyD4I	CCNGG	2 cut(s)	95, 110
StyI	CCWWGG	1 cut(s)	140
TaaI	ACNGT	1 cut(s)	88
TaqI	TCGA	2 cut(s)	179, 187
TasI	AATT	1 cut(s)	21
Tru1I	TTAA	1 cut(s)	152
Tru9I	TTAA	1 cut(s)	152
TspDTI	ATGAA	1 cut(s)	93
VpaK11BI	GGWCC	1 cut(s)	93
XmiI	GTMKAC	1 cut(s)	179

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.