RchiOBHm_Chr1g0355421

Signal peptide peptidase-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
48107363 .. 48108552
1190 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 318 bp
ATGAGACTAACGGCGTCATTGACGTCGTGTATGTATACTAGGTCGATTTTGAAACCTCATGTTGGAACAGTTCTTCTCGGTTGTGCCTTTTTTTATGACATCTTCTGGGTATTTGTTTCTAAATGGTGGTTCCATGAGAGTGTCATGATAGTGGTGGCTCGTGGTGATAAAAGTGGAGAGGATGGTATCCCAATGCTACTAAAAATCCCACGGATGTTTGATCCTTGGGGTGGCTACAGCATCATTGGGTTTGGTGATATTATCTTACCTGGAGCCTTTTCACTAAGGTATGATTGGTTGACAAATAAGAATATTTGA

Protein Analysis

105

Amino Acids

12.01

Weight (kDa)

8.66

Isoelectric Point (pI)

33.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_A22B PF04258 20 - 104 1.2e-33 Signal peptide peptidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 26
AccI GTMKAC 1 cut(s) 35
AclWI GGATC 1 cut(s) 215
AcyI GRCGYC 2 cut(s) 14, 23
AfiI CCNNNNNNNGG 2 cut(s) 62, 230
AgsI TTSAA 1 cut(s) 52
AjnI CCWGG 1 cut(s) 268
AlwI GGATC 1 cut(s) 215
AsuHPI GGTGA 2 cut(s) 176, 266
BauI CACGAG 1 cut(s) 159
BccI CCATC 1 cut(s) 176
BceAI ACGGC 1 cut(s) 27
BciT130I CCWGG 1 cut(s) 270
BciVI GTATCC 1 cut(s) 197
BfaI CTAG 1 cut(s) 39
BfmI CTRYAG 1 cut(s) 235
BfuI GTATCC 1 cut(s) 197
Bme1390I CCNGG 1 cut(s) 270
BmiI GGNNCC 2 cut(s) 131, 274
BmrFI CCNGG 1 cut(s) 270
BmsI GCATC 1 cut(s) 249
BpmI CTGGAG 1 cut(s) 291
BsaHI GRCGYC 2 cut(s) 14, 23
BsaJI CCNNGG 2 cut(s) 209, 224
Bsc4I CCNNNNNNNGG 2 cut(s) 62, 230
BseBI CCWGG 1 cut(s) 270
BseDI CCNNGG 2 cut(s) 209, 224
BseGI GGATG 2 cut(s) 187, 219
BseLI CCNNNNNNNGG 2 cut(s) 62, 230
BslI CCNNNNNNNGG 2 cut(s) 62, 230
Bsp143I GATC 1 cut(s) 220
BspHI TCATGA 1 cut(s) 144
BspLI GGNNCC 2 cut(s) 131, 274
BspPI GGATC 1 cut(s) 215
BssECI CCNNGG 2 cut(s) 209, 224
BssMI GATC 1 cut(s) 220
BssNAI GTATAC 1 cut(s) 36
BssNI GRCGYC 2 cut(s) 14, 23
BssSI CACGAG 1 cut(s) 159
BssT1I CCWWGG 1 cut(s) 224
Bst1107I GTATAC 1 cut(s) 36
Bst2BI CACGAG 1 cut(s) 159
Bst2UI CCWGG 1 cut(s) 270
Bst4CI ACNGT 1 cut(s) 70
BstACI GRCGYC 2 cut(s) 14, 23
BstDEI CTNAG 1 cut(s) 284
BstDSI CCRYGG 1 cut(s) 209
BstF5I GGATG 2 cut(s) 187, 219
BstKTI GATC 1 cut(s) 223
BstMBI GATC 1 cut(s) 220
BstNI CCWGG 1 cut(s) 270
BstSCI CCNGG 1 cut(s) 268
BstSFI CTRYAG 1 cut(s) 235
BstZ17I GTATAC 1 cut(s) 36
BsuI GTATCC 1 cut(s) 197
BtgI CCRYGG 1 cut(s) 209
BtsCI GGATG 2 cut(s) 187, 219
CciI TCATGA 1 cut(s) 144
CseI GACGC 1 cut(s) 3
CviAII CATG 3 cut(s) 59, 134, 145
CviJI RGCY 3 cut(s) 158, 234, 275
CviKI_1 RGCY 3 cut(s) 158, 234, 275
DdeI CTNAG 1 cut(s) 284
DpnI GATC 1 cut(s) 222
DpnII GATC 1 cut(s) 220
Eco130I CCWWGG 1 cut(s) 224
EcoRII CCWGG 1 cut(s) 268
EcoT14I CCWWGG 1 cut(s) 224
ErhI CCWWGG 1 cut(s) 224
FaeI CATG 3 cut(s) 62, 137, 148
FaiI YATR 7 cut(s) 32, 36, 60, 96, 135, 146, 291
FatI CATG 3 cut(s) 58, 133, 144
FblI GTMKAC 1 cut(s) 35
FokI GGATG 2 cut(s) 194, 226
FspBI CTAG 1 cut(s) 39
GsuI CTGGAG 1 cut(s) 291
HgaI GACGC 1 cut(s) 3
Hin1I GRCGYC 2 cut(s) 14, 23
Hin1II CATG 3 cut(s) 62, 137, 148
HincII GTYRAC 1 cut(s) 300
HindII GTYRAC 1 cut(s) 300
HphI GGTGA 2 cut(s) 176, 266
Hpy166II GTNNAC 2 cut(s) 36, 300
Hpy188III TCNNGA 1 cut(s) 145
Hpy8I GTNNAC 2 cut(s) 36, 300
Hpy99I CGWCG 1 cut(s) 28
HpyCH4III ACNGT 1 cut(s) 70
HpyCH4IV ACGT 1 cut(s) 23
HpyF3I CTNAG 1 cut(s) 284
HpySE526I ACGT 1 cut(s) 23
Hsp92I GRCGYC 2 cut(s) 14, 23
Hsp92II CATG 3 cut(s) 62, 137, 148
Kzo9I GATC 1 cut(s) 220
LmnI GCTCC 1 cut(s) 272
LpnPI CCDG 3 cut(s) 91, 255, 282
LweI GCATC 1 cut(s) 249
MaeI CTAG 1 cut(s) 39
MaeII ACGT 1 cut(s) 23
MalI GATC 1 cut(s) 222
MboI GATC 1 cut(s) 220
MboII GAAGA 2 cut(s) 65, 94
MmeI TCCRAC 1 cut(s) 43
MnlI CCTC 2 cut(s) 66, 172
MslI CAYNNNNRTG 2 cut(s) 138, 149
MspR9I CCNGG 1 cut(s) 270
MvaI CCWGG 1 cut(s) 270
NdeII GATC 1 cut(s) 220
NlaIII CATG 3 cut(s) 62, 137, 148
NlaIV GGNNCC 2 cut(s) 131, 274
PagI TCATGA 1 cut(s) 144
Psp6I CCWGG 1 cut(s) 268
PspGI CCWGG 1 cut(s) 268
PspN4I GGNNCC 2 cut(s) 131, 274
RseI CAYNNNNRTG 2 cut(s) 138, 149
Sau3AI GATC 1 cut(s) 220
ScrFI CCNGG 1 cut(s) 270
SetI ASST 5 cut(s) 26, 44, 58, 271, 290
SfaNI GCATC 1 cut(s) 249
SfcI CTRYAG 1 cut(s) 235
SmiMI CAYNNNNRTG 2 cut(s) 138, 149
SspI AATATT 1 cut(s) 313
SspMI CTAG 1 cut(s) 39
StyD4I CCNGG 1 cut(s) 268
StyI CCWWGG 1 cut(s) 224
TaaI ACNGT 1 cut(s) 70
TaiI ACGT 1 cut(s) 26
TaqI TCGA 1 cut(s) 44
TspGWI ACGGA 1 cut(s) 226
XmiI GTMKAC 1 cut(s) 35
XspI CTAG 1 cut(s) 39
ZraI GACGTC 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.