RchiOBHm_Chr1g0356331

Encoded by

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
48812672 .. 48812881
210 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 210 bp
ATGAAGTATTTCAATGCTGAAGTGATCGATGAAAGGGATCCTGTTCCTCTTCATGAGACTTATCTACATCATTGGGTTATTGAAAAATATTACGCCCAGACGAGTTCTATGGAACCAGAGCAGATTGGTTTCGAGGATATTAAAGAACCAGATTTTAAGGTTGCGAGAAATAGTCGATTGTGCTACTGTAGAGATTCCTGCTGGATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SURNod19

Protein Analysis

69

Amino Acids

8.37

Weight (kDa)

5.0

Isoelectric Point (pI)

50.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SURNod19 PF07712 1 - 61 2.2e-13 Stress up-regulated Nod 19
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 32, 45
AcuI CTGAAG 1 cut(s) 39
AgsI TTSAA 2 cut(s) 13, 83
Alw26I GTCTC 1 cut(s) 50
AlwI GGATC 2 cut(s) 32, 45
Asp700I GAANNNNTTC 1 cut(s) 8
BamHI GGATCC 1 cut(s) 37
BcoDI GTCTC 1 cut(s) 50
BfmI CTRYAG 1 cut(s) 187
BmiI GGNNCC 2 cut(s) 39, 114
Bsa29I ATCGAT 1 cut(s) 27
BseCI ATCGAT 1 cut(s) 27
BshVI ATCGAT 1 cut(s) 27
BsmAI GTCTC 1 cut(s) 50
Bsp143I GATC 2 cut(s) 24, 37
BspDI ATCGAT 1 cut(s) 27
BspHI TCATGA 1 cut(s) 52
BspLI GGNNCC 2 cut(s) 39, 114
BspPI GGATC 2 cut(s) 32, 45
BssMI GATC 2 cut(s) 24, 37
Bst4CI ACNGT 1 cut(s) 188
Bst6I CTCTTC 1 cut(s) 54
BstKTI GATC 2 cut(s) 27, 40
BstMAI GTCTC 1 cut(s) 50
BstMBI GATC 2 cut(s) 24, 37
BstSFI CTRYAG 1 cut(s) 187
BstX2I RGATCY 1 cut(s) 37
BstYI RGATCY 1 cut(s) 37
Bsu15I ATCGAT 1 cut(s) 27
BsuTUI ATCGAT 1 cut(s) 27
CciI TCATGA 1 cut(s) 52
ClaI ATCGAT 1 cut(s) 27
CviAII CATG 1 cut(s) 53
DpnI GATC 2 cut(s) 26, 39
DpnII GATC 2 cut(s) 24, 37
Eam1104I CTCTTC 1 cut(s) 54
EarI CTCTTC 1 cut(s) 54
Eco57I CTGAAG 1 cut(s) 39
FaeI CATG 1 cut(s) 56
FaiI YATR 3 cut(s) 54, 110, 208
FatI CATG 1 cut(s) 52
Hin1II CATG 1 cut(s) 56
HinfI GANTC 1 cut(s) 194
Hpy188III TCNNGA 1 cut(s) 53
HpyCH4III ACNGT 1 cut(s) 188
Hsp92II CATG 1 cut(s) 56
Kzo9I GATC 2 cut(s) 24, 37
LpnPI CCDG 5 cut(s) 54, 110, 129, 162, 187
MalI GATC 2 cut(s) 26, 39
MboI GATC 2 cut(s) 24, 37
MboII GAAGA 1 cut(s) 41
MflI RGATCY 1 cut(s) 37
MnlI CCTC 2 cut(s) 57, 127
MroXI GAANNNNTTC 1 cut(s) 8
MseI TTAA 2 cut(s) 141, 156
NdeII GATC 2 cut(s) 24, 37
NlaIII CATG 1 cut(s) 56
NlaIV GGNNCC 2 cut(s) 39, 114
PagI TCATGA 1 cut(s) 52
PdmI GAANNNNTTC 1 cut(s) 8
PfeI GAWTC 1 cut(s) 194
PspN4I GGNNCC 2 cut(s) 39, 114
PsuI RGATCY 1 cut(s) 37
SaqAI TTAA 2 cut(s) 141, 156
Sau3AI GATC 2 cut(s) 24, 37
SetI ASST 1 cut(s) 162
SfcI CTRYAG 1 cut(s) 187
SgeI CNNG 8 cut(s) 53, 65, 109, 114, 128, 145, 161, 177
SspI AATATT 1 cut(s) 89
TaaI ACNGT 1 cut(s) 188
TaqI TCGA 3 cut(s) 27, 132, 175
TfiI GAWTC 1 cut(s) 194
Tru1I TTAA 2 cut(s) 141, 156
Tru9I TTAA 2 cut(s) 141, 156
TspDTI ATGAA 3 cut(s) 17, 41, 45
XmnI GAANNNNTTC 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.